Description :
From Genome Similarity Track
Location :
Scaffold_65:261659- 265688
Transcript NameFunction/comments
Hyaar_Emoy2807568hypothetical protein
Hyaar_Emoy2807569hypothetical protein

Sequence
4029 bases(100 bases per row)
TCGTAATAGGGTCCAATGAGATCGACATGGACTACGTCGAATGGGTTCACGGTCGTGACAGTCCCGTGGTGGAAGAAGGCCATGATCCTGGCTGCCGCCA
TGAAATTTTGCAAGTTTGCAAATCATGCACTGCTTGACATATTCCACTATCGTAGTCTGCATACTTGGCCAGTAGAAGATCTGGCGCACAGTCTTGTAAA
GTCGTGTACTTGCCGGGTGCCCGGGGCTCTCATGGTACCAGTGCATCAAGTCGTCACGAAGTGTCGCTGGGACAATGACACGTTTGTGGTAGGTCACCAA
TGTACACCCAAGAAGGGCTATAAGCTGATAATCGGGGTTGTTGGAGCCCGACAAGCATGCAGTCTTGATTTTTTTCAATCATGGGGTCCGCGTCTTGATG
CTGCTTGATAACAAGTCCATGCATAACACATGGGGGGTCATCCGAAAAAACACTAAGCTCATCTGTCACGTCGGAATTTTGCAAGGTCTCAAATCGCATT
CGATAAAATGCGTCTGCCCCAATGTTCTTTTTCCCTTAATGTAATGCGGTGTGAGCTGGACTCGGACAGAAGCAGTTTCCAACGCTTGACTAGCATATTC
GTCTCCGTGGGGTAAATCAAATTTTTGTGATCCGTATGAACCACAACAGGAAATCCAAGAAGCATTGTGCGGTACTCACGAAGTGTTTTGACTATCGAAA
GCAATCCCAACTCCATTGTAGTTTAGATGATCTGGTGTTTGGTTAAGGCACGAGAGTAACATGCGATGATCGTCAATTCTTGCATGATAATTCCGCCTAG
TTGTGTCCCGCTTGCGTCTGCATACAGTTTAAATGGTTTGTCAAAGTCTGGAAAGGAGAGCAACACAGCCTCTGCAAAAGTCCGTTGTATAGCCCGAAAA
GCGTCCGTATCACTGGACATCCATGTGAAGGGAATCTTTGCACTGGTCAACCGATGCAAGGGATGACACAAAGCGGTTTTGTTGGGCACCATATCACGAT
AATAATTTATCATGCCCAAAAACCGTCGAAGCTCTTTTTCGTTGCGCGGGATCGCAATCTGTTGGATCGCTTGAATCTTCTTCGCTTGCGGCTTAATTCC
TTCCGCGGTCAGTGTATAGCCCAGATAATCTACTTCTTGTCGTAGAATATGGCATTTTTTACCATCCAGAGTGACATGATATTTGTCCAGACGCTCAAAC
ACCACTCGAAGATGCTCAAGGTGGTCATGTATGCTGTGTGAACATACCAGCAGATCGTCCAGAATAGACGATAACAAATTCAAGGTCACCAATGCAGGCT
TGATATTCGTCCGGCGCTGTTGAGATACCCATGGGAAAACGCTTGTACTGGAACTTCCCAAACGGTAAGCAGAAGGTGGTCAGCGGTCGACTTTGCTTCG
CCAATCGTCTTGCGTAATATCCCATGTTGGCATCCAGTGTCGTCATATACCGTACGTTTGCAAGTCGTAGCAGTATCTCACGGATCCGAGGAACGAAGTA
TGGACTGCGTCGGAGCCAACGGTTCAGCACACGATAATCAATTAGCAATCGCAGTGATCCATTAGGATTTATCACGAAAAGGCTGGAGAAGCCATCTCAG
AATCGTAGATTTGTTCCAGAACGTCAAGTTGGATCAGGTGCTGGATTTCGGCCCGTGCTGCGTTCTCGAGGCTCCGCGGAATAGGATACGGTTTGCATGA
ACGGGTTTAAATTCCGGCGATAGTGGAAGCGCATAATCGTCCAGCCGCATCCTTCCCAAATGTCCATCATACAAATGTCGATATTGTGCGAGGAGGACCA
GGTAAAGCTTCGATACCTCAGGAGAATAGATGGTCTGGAAGCAAGTCATTTGGTTCGGCAGCCGAATCTGCCAGTTCTTTAAACTCTTCTTCAGCATACC
TCGTCGCTGGATAAGTCGCCTTGACGTGTTTCCCGGTCCAAATCTTGAGACACTGTTCGTCCCACTGTACCGTTTGCTCTTGAAAGTTAATGATCAGTCC
AAGCGTTTGCAGCGAATCCCGTCCGATCACCATCGCATCCTTGCTATCTTCAATAACTTGAAGCAGTGCGTAATATTAGAGTCGGCTTTCAGCTTCACAA
AATGAAACTGGGCCACTAGAGTTCCACTGCTGGATACTTCTTGGCCTATTGTTTCAAATACCGTGCTCGTGCTTGGTTCGACACAGTAGCCGCTGGTTGC
CACAAAAGACTGATTGACGATAATTTTTGAGGCACCAGTGTCCAGCAAAGCGTCAAATTGTTTTTTGTCACGCCGGAGCTGCACAGTTTTGCGGAGTGGC
GCTGAGTGATCTTCCGGAGCCCGTTGAAGAAGTCCAATCAGCTTATATTCTTCATCGCTGCTTGACTCTTCCGCCTTACACTCATCTTCACTGCGTATAT
CTTTCTCTTTGAAGATCATTGGGTACTAGACGTTGAGAAAACCTTTGCACGCTTTCATCCCGTCGCTTCGTCATATGCCATAGTTCGTGGCCCAAATCTT
CACTGAAATCTTCTGGCACGGAGAGTAGCCCCACTGCTGCGTAGAACTGGTCAAATGACCATGTTTCTGCTCTGGCTTGATCCACTAAGAGTTCCACTTC
GTGTGCGAGGTCCCCTTCTATCATCGCAATTACATGCCAGCTCTTCTGGTCGTCAGTCCAGCCCTTTTTCTTTGCGAGACTCTGGAAGTCGCTGCTCCAC
TTCAGAAAGTCCCTGGGACTCCCGCCTTTGAACTTGCGCATCTTTATTTGCATGGTGTCGGCTGGAACTCCATCTTGCGCTGCCGTTAACACCACGGAGA
AGGTGACGTATTCTTCGTCATCATAACGTCCCATCTTGAATTCCTCTTTCCGATTCAGATTTGATTAAGCGAAATAACACGCCCTTGGCTCGCAGAGAGG
CTATCGGCTCCAGAGGTCTTGTTAGAAGGCCTTGGAGAAGGTGTTTAAAAAGAGAATGAATATATCTTTGCGTTAAGGCCTACCGTGCTAACCTAAGGGT
TCATCTGCTACCATCACTCAGCCAACAGTCAGGTCAGACATTTAACGGATAGTTCATAAGACATCCATCCAACTAATATGTCTTAAGACATCCAACGAAC
ATGTCATGGGGAGTTGCGTACCTTCAGGAATTTCGGCGGGCCAGACGCATTCCTCTCGAGACGAAAAGGAGTCAAAACTAGGACCGCCGGTTTCGTCACC
ATCATCGGTGGTCGTTGTTGCTGCTTTTTCGTAGTAGAAAGATGAAGCAGGTCGTGAGCAGGGTCAAATAGGGCGCATTGTGGCGGCTGGGAACTGTGAG
GATTGAGAGAAGCAAGTTGAGAAATCAGTTTCGCCGGAAAATTGTGGACCACCCAAGTGATGGTAAATTTTTAGGGAATGGTTGTTTAGCCACCACCCGT
TCGTTAATCAGCGACCACCCTCCAATAATAATATGATGTTATATTCATTTTGAAAACAATGCATTTAATTGGTCACGCATATGTACAACGTTATAAAAGA
CATTGAACAGATTTTTTGCAATATATAAAGTTGGGTGCTATTAAATTAGACGGACGTCGTGCATTTCATCTACATGGGCGGCAACACTACATACATTTAC
TAATGTTGTTCATTCTGTGGCTAAGAGACGAGCAAGATGGATATAGCCAGTTCCTTCCGGACCAAGATGAAGCGGGATGCTCTCGCTTCTCATTACGCGT
GGGCCATATACCCAATAAATGGACCGAATGTATTGCTTTACGGGCCGCTATCTACGAAGAAAGACAAGTGGATCTACATGCAATCAAGGATATGGTGTTG
GGATGTGCTCGTTCATGTAAAGGACTTGGCATCACAAGCTGAAGAATGACGATGGAAATGTCAGCGATCAGTTTGGCAAACTTATGATTCGGGGTTGGCG
CGACACGAGACGGAGATACCGAAGCTCACATGACACTTAACAAGCAACTATTGCTACGGTTGGAAGAAGCACGTAAGCGAGGTTCTTTTCGTATCGCTGA
GGGGTTTGACTAGGAACAGGGTAAGATTA