Description :
From Genome Similarity Track
Location :
Scaffold_190:26165- 27237
Transcript NameFunction/comments
Phyci_72398Hypothetical protein

Sequence
1072 bases(100 bases per row)
TTGTGATGCAGCCGCGGCCGCGGCTGCTGCTTTCTTTTGGGCTCGTTGTGCGTCGATACGACCTTGTACAATAGCTGTGAAGTCCATCATGTAAGCGGCG
ACGACGTCAAGATCAATCATAGCGCGCTGACCATGATGAATCACATCTGCCTCCGAAATCCCGCTGGCTGTCTTGCCACCAGAAGCATTTGCAGATACAG
ACGAAGAACTGGGGGCTCCTCCAGAACCAGAGCCGTCGTGGCTATCATTCCCCGACTGATTGTTTCCTTGGGCATGGTAGCTTCCTTCGACGTGCTTGAG
GATCTGTCCGTGAATTCCGCTGGTACACCGCTGCAGAAGATTGCCGATCGCCATGATGATCTGACCTAATGCCAGCGTTTTCTGTGTAGTCGCTCGAAGA
CTTGCGTCGGTCTCGTGCTGGAGACGAACACCCAGCAACTCTTCCCGCTCGAGAGCGCGTTGAAGCGCGGCGATGCGGTTGTTAAAGGTGAGAATTTCGT
TGGCGCGCTCCTTCTGGAAGGCTGCGAACTCTAGTCGCTTGGACTCACTCTCTTCTTCGTGTGTGATCTGGTTTTGGCTCAGGTCTCGGTTGGTCTCGCG
CAGCGTGTGATAGCGGTTGACCAAGTCGCTCACTTCAGGGTAGTCTTCAGGCACTGCTTCCTGCACCAGCTCAAGGTACCGCGTGTACTTGAGGTGGTGA
CGCACTTGCGCGCCGAGTGCGTCGCTCTCGCGCTGCAGAGCTGCGAGTTGCGCTTGCAGCCTCGCCACCTCCTGCTCCTTGTTCATGCGCTGCTTGACCT
CGTCACTGGCCCGTTTAACTGCGCGATTGCGCTTGGATTCGTTCTCCTGCAGGAACTTGTTGAACTTGATGAGCGACTCCTGCAGCTCTAGGTCCTTCTT
GCGCAGTCCCTCCTCTCGGCGGTGGAAAGCGTCCTCGCGGCGCGCGAACTCCTCCTTCTGGGCGTCCAACGCCTCCTGCACCTCGAACATCTGCCGGCGC
TTCTCCAGCAACCGCGTCGCCGGGGACACGTGGTCCAGCGTCAGTGTCTGCGGCATCTTGGAGCTGTGGGCG