Description :
From Genome Similarity Track
Location :
Scaffold_1409:2616- 3710
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1409-fgenesh-gene-0.1Conserved gene of unknown function

Sequence
1094 bases(100 bases per row)
GATGCCCACGGGCTCGGCGAGCCCGTCGCCGATGCCCGTGATAAACACGATGATGAACGTCAACGCGCCCTGGTCCGCGAAGAGCCACTTAAAGAAGAGC
ACGATGATCATCCCGGGCGCGATGTTACCCGCGATGATCCACGTGAGCGTGTGCGGCCGGTCCTCGGGCCGGTCGAGCGAGTTGAACTGGAGCATGAAGA
ACTTGGAGCGCTCGCGGATGGGCTTGATGAGCACGAGGAAGCCCAGCATGCTGAAGAAGTCCCCCCAGGCGAGCGGCAGCGGGCCGCCCACCTCGGACTT
CATCACGAGTGGCACCATGTAGGCCGCAAAGTGCTGCAGCTTGCGCGTGTAGTTGACCTTGAACTTGCTCGACTTGTTCGTGATGATGTAGCCCTTCTCG
TCCACGTCGCAAAAGTGGCGGCAGATCAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGACGCCGAGTTTGGGCGTCTGCATGAGCCAGAAGTGGCCCGACGTGAGCAACTGCGGCTCGTAGATGTA
CGTGAGCACGAAGAGCAGCGCGAGGTAGATCATCATGCCGACGAAGAACCAGAAGTCGAACGTGTGGAGCCAGTTGGCGTCGTAGTCGCCCGCGACGTCG
CCTTCCTCCACAAGCGAGCTCTTCGGGCGCTCGATCTGGTTCAGCGCCGTCTGCTCGTTCGCCGGGATCGCGCCGTAGGACGACGGCTTGTTGTACTTGG
GCAGCCCCGGCGAGCCGGGCACCTTCCAGATCACGCGCAGTAGCACGTAGATGAGCACGAGCGACATAACGGGGATGAAGCCGATGAGCAGACCCTGCCA
GAGCGAGATCTCGTGGTCCCAGTTCTTGGGTACGGCGCTCTCGGCGATCGCCAGCGCGGCGTGGAGGTCGATCACTGTCGCCATGGTCTCGTGA