Description :
From Genome Similarity Track
Location :
Scaffold_33:261596- 265473
Transcript NameFunction/comments
Phyci_147264Hypothetical protein
Phyci_92436Hypothetical protein
Phyci_222003Hypothetical protein

Sequence
3877 bases(100 bases per row)
TTGCCCTTCACCAATGCAGTGTCTTCGCTGCCAGACTCCTCCGAGGCGCTGTTCGACTCGCTGTCAATGTCCGAGGCACTGCCACTGTTCGAAGTGCTGT
CGAACAGCCACGACAGGTTGCCGCTGCCCTCGAAGAACTCAAGCATCCAGGACGGAATGCCGCCGCTGCCACTGGCAGACTCCGAGCCGCTAGCAGACAC
CTGCGACAGGTCGTCGCTGCCGCTCTGAGAGTCCTCTTCAACAACGGGTATTTTTGTCGTCTCGGCCCTCGAGGCCTCCGTGTCTTCCGACTCCGACGAT
TCCTTGACCGGGGTCTTGGTGGCATCCGACGACGAGTCCTCCGACGAGCCATACGATGACGAGGTTACGTTGAACTTGTTGCCATCGCCGCCGGCAAGGA
TGTCCTCGATGTAGTCCATGACGTACGTCAGGCGAGTAAAGATGCCGGGCTGCTCACCGCACTTGCTGCCCCAGCTCACGCAGCCGATAATGATGTCGTC
GTCAACGAGAAGCGGCCCGCCAGAGTCGCCTTTGCACGTGTCCTGGCCATTGCCCGTTCCGGCGCACAGCATACCCTCCGTGACACGACCAACGTACTTC
TTAAACTTGCCGCACTCGGCGTTCGAGATGACGGGGAGGGTGACCTCCTTCAGGACAGGGCTACCGAGTATTCCGCTGGTCTCCGTCTTTCCCCAGCCAA
CGGCGGTGCCCATGGTGCCGACCTTGTTGTCGGAGCCATCGGCAGCACACAGCTTCGCCGTTTTGCGCTTCACCGGCTTCTCTAGCTTGTACAGACCCAC
GTCGTAGCGGTGGCCCTTCTTCTTGTACAACGGGTGACGGAAGCCTTCAGCTATCGGAACCGTCACCCCGCCAGAGCTCATGCTTTCGTTCGAGCCAAAA
CTGGCGATCATGGGCAAACCGTCGTTCATGATGCAGTGCCCAGCCGTAAGGATGTACTGGGGCGCGATCAGCGTGCCGCCGCACAGATTTAGCCCGAAGA
ATGAATACTGGAGGCTAGCAAGGTACGGGTACTTGTCGATGTTCGCCTCCGACCCGCCGTAGATGTAGCTCTCTTCGTTGGTGGTCAGACCGGTCTTCTC
CACTTTAGTAGTGTCCTCCTTCGCGACGTCGGAAAAAGAATAACCGTACGCGTACGTCGACAGCCACGCCAGTGTCGTGGCAAACACGCCAACCTGTATG
ACCTTCATCCTTCAGATGATTACAACAGTCTCCTGTCAGTTCACAGCCCCTCCCAAAAGCCAGAATGACCAGCGCATTGACGGGGAAATCCCGGTCTGAC
CGGGATTTCCAGACGTTGGCGACCACATCTCAATCGACTATCCGTCAACTTGACGGCGTCAAGCCGGATGGTGCTCAAAGCACGGTGCAGACGCGATACA
TGTACAACTCGCAACAAGAGAACGCGCTGGAATCTCATGAAACATGGCTACAGTACTACAATATAATAGATCACCTGGCGAGTTCCTAGctaggttctcc
gtccacggggatacagtaaacgacgttgccattccccgaagctgtccccagattgctggagctgggaattgtgttgctgctacatgtataatacatgtac
ccccacacaccttgtcaaaatcattttctataacattcagaactcatgcacaacacgagggaggacgcctctcagttggaaatttgcgtcgtaccggggt
gcgaacaagcatcatggagatgctgttgtcgcccgcgccggatgcggtgcaggcctccccaccccctgcgcagcccgtcactgtgagtgccgctggggac
ggaggagcttccgcgatgaagctgagacgaagcgcgcaaatgaccaccaaagacgcgtcgtcgcctttgtcgtcacgatcgtctgcctctccgaattgat
gcgtatctcggaataaaatgttcaaacaattcccacccttggGattctcttgaattcgttggcgtctgacttccattttgtatgaaaacttttgcgtttc
ttgtgtgtttgtgcgcgcacgaattcgtttaacccctggcgactttcgtgttattctgagcgacaatccagagttctcacgactttgttggcgtcagata
gctaccgtaatacacgaaactcaataccacccagtattacagacgcAACACAAACGTCgtggtggtggtggtggtggtggtgTGTGTGTgtgggagggaa
tgagaccacgcgtggcggagacacttaccccctctctccctccctccctcccccaagttcgggaccacggacagcgtctcgttgtacgtggctacctcca
ccacagctgcagaaggaaggtgggtggttagcggccactgtgtatgttatttaaagcggggactataacccagctgcatcagtgcccaatcgttgtcgct
aaaaagcatgacatcgcaatattccgaaataggactgcatgtacggcttaatacggtttttaattgtgcacttgagtctacatttgcttgcgtatgtact
ggtgttactactaaccatgccttggcgtgatctgcaacgctgttctcggatttcattaaagtcattcaaccagtggggctgattcctgcgtcattgacat
ggttttggcgtggcgtcgctgataggaagccttgtccccatattctgactgatctcgcCGCGGCCCTCTACCAGGCTGCGCGCTCTCTACCGAGCTAAAG
TCAAATTGTTTCGTTTTTCGCTCGTGGACCTTTGACCTGCGACCTTTAacctgctacctgcgtcctggacctcttacacttcctgttgatctctaggaca
tcaccttcttcttctacctgctgtcgtgatttcatgatgtcgtcctccgcgttgtcctccgcgttgccctctgctggtaagctcgaaggagctggcttga
tagaagccgagcagatgactTCCCCCCTCAGTCGGAGGCCAATGGTGCTGTGCGTGAACGGCCCGCCCGGCACCGAGGTACTCGGCGTACTGCAGGTTGG
CTGGACCGAGCGCGCGCCGATTGAAGCTCGTCCAGCATACGAGCTCTAGATGACCCGGCGTCTCCCGCCGCCACAAATGAATTAAAGAGGACAGGAACGT
CCGTTCGAATAACCTCCGCGGGTTCCCAAGAGGCCTCGATGTCATCGAGCCCGAACCACTTGACGAGTATTTCCCACTGATGGGTGTCTGGGATCACACG
GCAGTCACGAAGCGCCTCCACAAGATGCCCCCCCCCCCTCACCGTAAATTGCTTGCTTTCGCAGCTTTTCGACTTGGCCACGACTGGCATCACGATAGAG
CTGAAGTCATGAAGCGTGGCGGATCGATACCTCAAACGGTTCGACAATGTCTTGCACCTCAAATGTGTAATCGTTAACggcgcgcacaattttctttggt
ccgcgccaaactagtgcgagtttgttcccaCTACGGCCTGTGGGCGTAGCCGCCAGCACAAAATCCCCCTCGTTAAACGTTTGCAGTCGCACACCTTGGC
GGCGAGCATGCCGTTCCCGGGCAGTACGCCGGCGTTTCTCGCTGGCGTCAACCATTTCCGCATGTATTCCATCGAGTGCCACGCGTACTGCTGCTAAATG
GCCTGCAATCTCGTCCGCCACCCACGTCACGGttgcatttccggcagggtctcgtgggtgcagaacacggaggagttgtgtgttaccaggtagtgctgtg
aacgccgtcaacggtgtagcgccaccgagacgattggctggcattgcattcaatgcgGACTGTACCacaggcagggtggcaggccagtcttggatacgca
atctgcgctcgctcagtaacgctttcacacctttgagcacctcctattgaccacctccaccgtgccgttggcgcgag