Description :
From Genome Similarity Track
Location :
Scaffold_1919:2615- 4273
Sequence
1658 bases(100 bases per row)
GTAATCATACAGAAGACCTCCCCAAGAGAGGTGAGCTGTTGGTTCCCATGTCGGCTCATCTTGGTCAGCCCATTTGATCTTAAACTCTCAGATTGATCGC
GCCGTTCTCGCTAACATGGGCGTCCGATCATCGAGAATCTCTAGGATCTCGCTCTCACCGGCTACTCGATCTGGTTATCAGCTACCCTCAGACAGGAGCT
CCGAAGTCGAATAGCGAATCCTCAGTCACATCTTGCGTCAACCGAGTTTTCGGCGTAACTTCGAACTCATTCACTGCCTTTAGGTGTGGCACATGCACCA
CTGAGTAAAAGCGGTAACCACTCCTGTCGGGCAGTTCCAACTCGTAGGCGTACTctttcattttcttcttgacgcgGAACGGACCGTGCCATCGGTGAGC
AAGCTTCTTTGTCAGCCTGGCTTAAATCGCTCCATGTACAGCCAGCCTCGACTTCCAGGCTGAAATAGAGATCTCGGTGCTGCGTCAGTAGGTTCGTCAA
GGTTGTTCGTCATCTTGGTGTTCGACCGGCGTCTCATCTCTTAGATCTCGAGGCACAGCTGCCATTTCCTTCCGACTCAAGGCTTCATTGTGTTCACGGG
TTCGTCGGGCTTTCTCAGTGGTTTGATATTCTTCCGCCATCGCCAGCGCAATTTCTTGCTGTCAGGTAACTTCTCAGCGCCATACAATGCATCCGGTTGT
CGTTGTGATCCTCAACGAAGCGAGGACGCCATTGCTTGGAGTGTGGTATGTGCAGCCCAGCCGTGAGCGAGGTAGAACGGTGACTCCTTTCTTGTCGTGT
GTTGATTGCAAAGACCAACCGCTCGGCAATTTCATCTTAATCCTGTTGGAGCGGTTCCTCAACATAGTCCTTCATTAACTGCATCATTGTCTTCACCGAT
CGCTCTTGTTGTATGTTGGTTTGTGGACGATATGTCAAATTTGCTCTTGAGTGAGACTGCGTCATTTCTGCGAACGCTGGGAACACCTCACTCCTGAATC
GCGGATCTCTATCATCTCGGATCAAAAGCGGTGCTCCAGAACGTCGTTAGGCACACTCTTCGAAAAGTCGGGCCACCATGAGTGCAGACGTGCCCGACAT
TGCCTTGGCGATAACAAATCCTGTGAATGAGCACTGGAATAGCAGAAGCGCTGTGTTGCCTCTCCGAGAACTGGGTAGCGGGATGACAAAGTCTATTGAC
ACGATCTGGAACGGGCGCTCAGCGAGCACGTTGCCTGGGGAATATCCTCGGAGATAAGGGAGGTTTTGCTCGAGGTACAGTCTGGGAACGACTTCACGTG
CTTCTCCACATCCGCATAGAGACCTATCCAATAATATTCCCGTTTCACTCGCTGGTAGGTTCTCACCACACCTTGGTGGCCTCCTTCCAACGAGTCGTGA
CAGTTCtgtagtacttcttgaaTCATTGCTGTGGGTTCTACCAGACGCAGCTTCATTCCTTCCTGCTGTTCGTCACCTCGCCAACGGTTTGCACCCACGT
AGTAGAGTAGACCGTCTTCTGTCAACAAAACCTTGTCGGCCAGCTTCCATGCGTCACGGGCTGCACTGTCCTAGCTTCTCAACTTCGCCTCTGATGGCAG
CCTTCAAGTTGGACCACCTcagatcttcatcttgagctttGGCAATTCTCCGACGGCG