Description :
From Genome Similarity Track
Location :
Scaffold_332:2615- 4193
Transcript NameFunction/comments
Phyta_totarag7219cystatin-like cysteine protease inhibitor domain-containing protein

Sequence
1578 bases(100 bases per row)
CATCCAACCACTAACCATGGGGCTGTGGTCCAGAGACGGCGTCACGCACAACGTGTGGACTGCCTACGTGttcacgctcttcttctggtctGCCCGAAGG
TCTGTAGCAATGTGTCAATGTGTCAATGTGTCAATGTATCACACTCACACCTTCTACCACTGCAGTATCCTATTCCAACAGGTCGTGGCCGGCTACGTGT
TCGTGCTCACAGCCTCTAACAAACCTGTGGGCATCGTCAAGGGCATCCAGGGCATCTCGCAGCTGGTCTTCTCGCTTCCAGGCGGCTATTTCGCTGATCG
CATCCGTCGCGACACCATCCTCAAGCTCTCGGGCGCTATCGGCGTCGTCGGGGCCgtcatcaccttcttctccgtggagatgacgtcCATCAACGGTCTC
TACGTGGCGTTCGGGCTGTGGGGCCTCTTCGCGGCCTTCCAGAGCCCCGCCATGGAAGCTCTGTTCGCGGACTCCATCCCTCCTGGGAAGCGCAGCTTCC
CCTTCATGATCAAGTacaacatcagcaacttGGCGCAGATGCTGGGCCCCGTGCTGAGCATTTTCCTGTTCTTGTTCTACGGAGACGAGTGGCAACTGCC
GGAGCTCAAGCCGGTGCTCGAGTTCGGCTGCGTGTTGGTCATTATCGGCTCCTTGGTACTGTTCCAGTTCGATGACGACCGGGCCAAGGACTACATGCTG
GACAAgaccgaggaggagaaagaagaagaagaagagttgctggagaagatgagcgcgccgtcgccgctgcgCACGCCCAAGCTGGTTGGCAACGGCAGTG
AGATCGACATGGTGTACGACTActcggacgaagacgacatcACTGTGAACGACAAGTCTCCCCCCACGGTCACGGAAAACACGGCACTACTGCTACTGAA
GGGAAAAACCGCGAAGGAGATGGATTtggagcgccagcagcgcttacaggaggtggacgacgaggaggaaggcTACATGGCGCACATTGATGCCAAGTTC
CTCTGCTTCCGCACCAAGCACGTGCCGTACATTTTATTCTTGTCGGACTTTATCATCAGCAATGGCGCTGGGATGACGATCAATTTCTTCCCGCTGTTCT
TCAAAGAGGAGTACGGACTCACGCCGATCCACGTTTGCGCGCTCTTCATGAGCCAGCCGCTCGTCGTCATGATCCTGTCATTCATTGCACAGCGTTTGTC
CAAGCCATGCGGCCGCATGCCGATCATTGCGTTCACACGTACATTCTCCGTAGCGTGTCTGTTCTCCATGGCCTACGCGCAGCCGATGGCTCTGCAGATT
GCGCTCTTCCTCATGCGTGGCGGTATGATGCGCTGCTCCCAACCTCTGCGTCGGTCAATCCTGATGGACTATGTGCCCAAGAACATTCGTGCGCGCTGGA
ACGCGCTGGAGGGTCTGTCGGTGTTTTCCTGGTCGGGCAGTGCAGTGCTGGGAGGCTTCCTCATTGATGCGTACGGTTACCGCATGTGCTTCATGATCAC
GTCGCTCGTCTACTGCGTGGGTCTGAGTATGGAAATGGTCCTCCTGCCGCTCACAAAGCATGCCGTTGAAAGATAGAG