Description :
From Genome Similarity Track
Location :
Scaffold_347:26148- 28093
Transcript NameFunction/comments
Pytap_DAOMBR444snap-pag1_scaffold_347-abinit-gene-0.69Sodium/potassium-transporting ATPase subunit alpha

Sequence
1945 bases(100 bases per row)
CCGTTTTAGGGTCTTGCCAACCATAGTCACCTGGGCCGAGACCTCGTGCTTGGTTCTCTTCTTCAATATCTTCACTGGTAGGCCCCCAAAGGATACCAAC
CTTGTGAGCAATTGCCTTAGCTGTAATAGGGTGATCGCCTGTAACCATAATAACTCGAATACCGGCCGTTTTGCACTTCGCGACTGCAGATGGAACCTCT
GGACGAGGCGGATCGATCAGCGCCATCAATCCGATGAAGCAGAGAGGCTCCTCTATCTTCGGATCAGGCTTCGGGACGACGTCGTAATCGACATCcTtCT
CACCAAGAGGGAAATTCGGGTTATCAGTGTTGAACTCGTAGTTTGGACCATAAATGGTTGGGTCCAGCACCTTTTGAGcAAAaCCCAATACTCGCATtCC
TTTTTtCGACAACTCCAGCTGGCGGCTCTCAATTTCAGCAaGGCGCTCAGGAGTCAAGTCGACTTCCGCACCATCAAGAAGAAGTTTGGCGCATCGAGAC
AGAATTCTCTCTGGTGCACCTTTCATCACCATCAAAATCGGCTTCGAGTCGTCGTTGTCTTGCTTGTGAAGTGAGAGCTGGTACTTGTTCTTTGAGTTGA
ATGGCACCTCCTTtAGCTTAGTGTTGGCTGAGCGGTACTCAATGATATCACGCTTGTCGTGACAGAACTTGATCATTGCTGACTCGGAAGCATCGCCAAT
TGTGTCCCACATCACCATACCCAGTTCTTGTCCGCTGCTGGTCGTCACCATGCTCTTAAAAGGCTTTGCCTTGCCGCGAGCGACAGTACCGTCTGCGGCG
AGAACCTTCTCGAATTTCGAGTCCTCGTCAAACACTGCATTGTTACATAGCGTTGCACAACGCTGCAATGCTTGGAACGATGGGTTTTtCAAATCATAGC
TGGCTACAGGAGTGATTGAGCATTCGGCATCGTAGATTGTGTTGTTGTAAACAACATTGGCGACAGTCATGATGTTCTGCGTCAGTGTGCCAGTCTTGTC
CGAGCAAATACAGCTTGTTGACCCGAGTGTCTCGACGCCTTCGAGGTTCTTCACTAGAACAGACTTTCGAGCCATGCGACCAGCGGCtAGACTCAAGCAC
ACCGTCACAGTTGCAAGAAGACCTTCTGGGACGTTGGCGACGATGATGCCGATCATGAACACGACGTTTGTGATGATGtCCGTTTTGATAATGAATCCAA
TGATGAAGAAGATGAGACCAATGGTGACAGCGACTACAGCAATAATGTGCACGAAATGGTTAATCTCCTTCGCGATCGGTGTCATCTCAACATTCGTAGA
aGTCGCgaGGCGGGCAATCCGACCCATGACAGTCTTGTCACCAACACGGATAACAACTCCCTTCCCGCTCCCCTGAGGAATGAACGTGCCGAAAAAGCAC
AAATTCTTTGTTTCGAGCGGGTTGTCATCAGTACAATCCGGAATGCGCTTCAAGGGTTCCGGTTCTCCGGTGAGGCACGAGTTATCGACCGCCAGATCGT
CCGAGCACTCTAGGATGCGAATATCTGCTGGTACCTTATCACCACCTTTGAGCACGACGATGTCTCCACGCACAAGCTGCGTTGCATCAACCTTTTGTGA
CTTTCCCTCACGCACTACTGTGGTCATTGTTGGCATCATGTTCTTGAATGATTCCATCAGATTGGACGACTTtCGGTTTtGGAAGTACGAGAAGGTACCG
GTGATGATCACGACCAAGAAGAGCACAATACCGAGGTACAAGTTATTCGGGTCACCTTGGATGCCGTATAGGATGATACACAATGCGCCACCTAGCCAAA
GGAGCAAaCTGAaTAAGCCTGTGAGTTCGCGGATGTACTTGACAATCTCAGGCGTTtGTTTtGGAGGAGACAAGCGGTTCAGACCcTCTGTCTCCAGGCG
gCGATCGACTTCATCTTGATGCATACCCTACATCGAATCATTTTa