Description :
From Genome Similarity Track
Location :
Scaffold_515:26142- 27732
Transcript NameFunction/comments
Phypl_g9068hypothetical protein

Sequence
1590 bases(100 bases per row)
GGGATCGGAAAGAATAACGTTGAAGAGACCGTCATACTTGCAGCGGTATGGATCAATGACAGCGTCGTGATGAACACAGCAAGCTGGCGCCACGACAGCA
CAGACCCGTTGACCATGAACGTTCCTTGAATGAGAAACGTGTTCGCCGTGACTGTTGACAGCATCAGGAGACGAAGCCAGAACCCATAGTTTGCAGCCCA
CCCGTCGGCAGGGTCCTGGAGCGGTAGTAATTCTTGTAGAATGACAAGCGCCACCATCGGCAGCGGTGTCCCGATGCATACCAGGAGCACACGCGATAGT
GACGTTCTCCGTCTGTACTCGTCTAGGGCCAACGATCGCTCAATAGAGTATTTGCCACCGTAGTAGCTGACTTGTAGTGAGGTCCAGACGCTTAGTAGAC
GACTTAAGCCAGTGTGAAGTCGATTAGGAGTGGAATTAGCGagttcgtcgtcggtgcGATGCTCGGTCTCCTGGCCTGGAGCAATGGAAGTCATCGCAGC
ATCCACACGAGCGTTTGGAGTGGGTCAGGTCGAGGAACGCGTTTACCAGACCAAGACTGAGAACCAGTTCACTATTCTGGTCGTGAACATAGAAACTTGA
CTACCTCTCGACGGAAATACCGTCAAGTTCCATCGCAAGCTAGACCATCAGTAGCCTTTTGATTCGTCCACCGTCATGAGCCAGATAACCGTGGCCCGGG
TGTTCCAGGTACCACTCAAATTTGACCAAACACACCACATTTCGTTTCTTTGCGGGCTTATCCGCTGACATTAGGGTCATTCATCCAAGAAAACTGCAGA
GTAAAGTCGACACCTACGTCATGATAAACGTTGGATTCGGTCAGTGCAACCGGGGAAATTGAGACACAAGCTCCCTTCATGAGTTAAACCACAGCACGTA
CCGAAGTGAACAACTCGAAACGCTAAAATAATCAGCATCCACGTCATCACCTTGCCTTGTACCAGTGCTGTTTGTGTCTCCAGAACGAAAGCAAGTTGGT
AAAAAGCCTTCATGCCATACTTGTGCTGTAGCATTCCTGCGAGGGCTGCAAACGAGGCAAACTCGAGTATTCCAAAGATGAATACAGCCTTCACCGAGTC
TGCTACGTTTTCCCGAGTGACGCCTTTTAGCTCTGTATGATATTTAGCGCTTGGGAGATAGACCATCACGACCATAAAGTTGGTGTAGAACATAGCGATG
CTGGTGTGCAAGTAGGAGACCAACACGAGGCACTCAGAAGTAAAAAGAGCTTCCAACCCGTCTCGACAAATGTTTGAGCGGCGATACGCGAGCGAATTCT
GCCGCGAACTTCGTCGTTCGGTAGATTGAGCTCCAGAAAGGGGGAAAACTGCAATTGAGGACGGAACAATCGGTTTGACACTAGTTGCTCCATGCCAACG
AAATAATCTGGCTCCAATTCGCGAGACAAATTGACGCTGCCTCAACTTGAACGATGTAAGACGGACAGACGACCCGTGTAGGCAGCTACGTgagctcgct
cgagagcCTTTTCTTTCTCGTTGAGCATTCTCTAAGCGATTTAGGCAGTGTTGACTGGAGCGAGATAAATTGTGAGAAAGACACGATCGT