Description :
From Genome Similarity Track
Location :
Scaffold_66:261408- 266334
Sequence
4926 bases(100 bases per row)
ACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCATCGCGGGTAGACTACCTGAACCTCCGAAGTTC
GTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAGCC
TGGTGGTATCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGGAGAACCTGCAGGCTCC
GGCGGCGGGAGCAAACCCGCCTCACCCGAAGCCAATACGGCTGAAGGTAAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTTCACTTCTGGGTCCGAGAA
GTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGTGCTAAGAGTTGGGTGTACA
CTCGGGAAGCGACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCCAACAGCTCCGAGCCGCGTTCCTCCCGGCGAACTACGAGTACCGCCAGCG
TTCGCGCTTCCTCGCGTGTAAACAAGGAAGACGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGAAACCCACTCAAT
GAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGGCAAGCACCCTTGAAGAGGCGATTC
AAGTGGCTCTTCAAGAAGAATACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGTTCCTTGTCGGCTCCCGGTCGAACAAGCCCCAA
CGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGGAAGATGGGCCACTTCAAGCGCGACTGTCCCGCGGAA
AGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCAGGGAACCAGTAGGGGCGGG
GCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGTGTACCACGGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAACAGGCG
AAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGGTACGATCACCCCTTTAGAATCTTGATTGACTCTGGGGCGTCGAAGAATTTCGCAC
GCCGCCAGACGGTTGCTCGTAACAGCAACAAGTTGTCCGAAGCTTTGCGAGAAAGCAAGGGCAACGGGACGGTGTCAGTGCGACTGGCCGACGGGAAGGT
CGTCACTGTCCCCCAACGTCCAAGTGGATCTGGCTGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATATGATAT
GATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCCGACAGAGCATTG
GTGAGTCATGTTCCCACCTCTGTCAGGACCCGGGGCGCCCGCGAGGGCTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGTCGTCGACGTATATG
ACGACTCCGAGGATGTTTTGATGGTGGCCGCGCCCAGAAGAGGCGCCGGCCAAGTGGGTAACTTAGGTCCACAGGCGGGTAACTTAGTTCCGCAGACAGC
TGCAGCTGTCATGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCATAACTGAAGAGGAAGACGTCGGATAC
GCTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACAACAGTACCAC
ACGAGGCCACGAGTGCCTCGGATGTCGTAGCGACGACATCCCTAGACGTGGGCAGCAAAGCTCCCCGTCACAGAAGCCGTCGGCAAAGACGCCGCCGCCG
CCTCAAGTCGGATCCGAACTTCGTTCCGATCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCCGGTGGAAGAGTGCTAT
CACATCTTCGATAGCGAGACGGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGAAACAGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGA
CGGCTGAGTCTTTCCTGGCCAACCTCAAGGCTGGAGAGATCGCTGAGATGGTACTCATAAGACCTGAGACCACTCAGGAGGAGCTGAACTCCTCCTCTGT
CTTGGACGAGAACGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAAGATCCGGTGTATCCTTTGGTG
ACGGAGTATGCGGACGTGGTGAATAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATT
GTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATC
CCCGCACTCGACGCCGACTTTCTGCGTTCGTAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAA
ACACCGATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATGCTGATGC
GAGAGAGTGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTT
CAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATTTTCGTCCATAGCCGTGCCGAGGGAGGCAAGACG
GCCATGGAGGTGCATCTAGGACACCTCCGTCGAGTGTTGGACGTGATGCGAGCGAACCAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAG
AGATCAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAA
GGATCTTCGAAAGTGGTTGGGTTTGGCCAACTACCTTCACAAGTACAGCGCTGGGTACGCGGGCTTCGCTAAGCCTTTGTCGAGCCTCCTTCAGAAGGAC
GTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAAGCCCCTGTCCTGGCTCTGCCGGACGAGACGAAGC
CGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGGTGTGCATTGCTGCAGGACGACACGGCTGGACAGGAACGAGTCATCTCATTCCAGTCCAG
GCAGCTCAAAGCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTCCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCT
ACGCCCTTTGTGATCTACACAGACCACGCGTCCTTGAGGACGGCGACTAACTCGCCTCACCTCTCCCAACGGATGGCGAGGTGGCTGTCCTTCTTCGCGG
AATATAACTTCCGCGTCGAGTACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTAGGCGTCCCGACTATGAGTTGGCCCACATCACGCGGGT
GACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTAAGGCCGGAACGAGCGCGAAGTCC
GACTGGCTCTCGTCGCGACAGCGCTCACGGCTCCACCGATATGAGTTGAAGGAGGGCCTCCTCTATTATCGGGTAGAGCCCACTGATCCTCCACGGGTGG
TTGTACCCAACGACGAGGATCTGAAGTTCGACATCCTCGCGGAGGCGCATGACGCGCCCTCCAGCGGCCACATGGGCCGCGAGAAGACCTTTCTGTCGGT
CTCTCAGTCCTTCTGGTGGACCCACATGTACAAGTGGGTCGCCCGGTACGTCAAGACATGTGAAACATGTCAGCGGGTTAAACCCGCAGGGCACTCTTCG
GCTCCACTACAGAGCCTGCCCGTACCGGCTGATTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCAACGGACACGGCAACACCGGAA
TTTTGGTGTTCGTGTGTCGGCTGAGCAAGATGGTACATCTTGCTCCAGTTCCCGTCACTGTGACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGT
GTTCCGCTATCACGGTCTCCCGGAGACGATTGTCTCGGACCGAGACCCGCGGTTCACTGCTGCGTTTTGGAAAACGCTGTTCCCTTTACTGGGAACTCGT
CTGCAGATGTCCACTGCGGATCATCCGCAGACAGACGGCCAAACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCGC
CACGTACGTGATCGACGCAGCATCCAGTTGTTGAGTTTGCGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCGTTCTACTTGAACGGCTTCCG
CCACCCCAGAGTGCCTCTCACTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNTTT