Description :
From Genome Similarity Track
Location :
Scaffold_205:26140- 27296
Transcript NameFunction/comments
Albla_Nc14098900DEAD box helicase putative

Sequence
1156 bases(100 bases per row)
CGAAAGGCCTTCTCCGATCCAAATGCAAGCGATTCCGATTGGATTGGCCAAGCGCGATATCATTGGGATCGCAGAGACCGGATCCGGGAAGACAGCTGCA
TTCTTGATTCCGATCATCGCGTACTTGTATCATCTACCCGCCGTAATGCTTGAGCGTACCGGTGAGCAAGGTCCATTGGCGTTGATAATGGCGCCGACGC
GGGAATTAGCGCTTCAGATCGAGCAAGAAGCCATCAAACTTTGTAAGCACACACAAGTTGGCGTCGTTGGGAGTCAGAATCGCATTCGAACATTGTCGGT
GGTGGGAGGACAAAGTATCGAAGATCAAGCATTCAAGCTTCGTCAAGGCGTGGACATTATCATTGGGACTCCAGGTCGACTGATGGATTGCATGGAGAGC
CATTATCTGGTGTTAAATCAGTGCAATTACGTGGTCTTGGATGAAGCAGATCGGATGATTGACATGGGCTTTGAGCCTCAGGTGGTCGCTGTTCTGGATA
ATATGGGATCGTTGTTGAAATCGGAGAACGAGGAAGAGATGGAGAAGCAGTTGGAACGCGCCAACAACGCGCAAGAATTTCGATATCGAGTGACCATGAT
GTTTAGTGCGACCATGCCGACGGAAGTAGAGCGTTTGGCCAAGACATATCTTCGACATCCCGCAATCATCAAAATTGGAGACGAAGATTCTGGGAAGAAT
AAACGCATTGAGCAGCGAGTTGTGTTCCTCAACAGCGGGAAAAAGAAGCTTCGATTGCAGCATCTTCTTCATGAGACTCTGTCGAGTTCTGGTCAAGTAA
GAATTTCCAGGAAGGAGAAGGTCGTTGATGGCCAGAAAGTGATGGTGTTCGTAAATATCAAGAAGGAATGTGACGTGCTAGGGAAATACTTGGCGCAGGA
AGGATTCCGAACGACCATTCTCCATGGTGGCAAATCACAAGAGCAAAGGGAGGAGAGTTTGCGTGGATTTCGTGAAGGCTTTTGTGACGTGTTGGTGGCA
ACGGATGTCGCTGGAAGAGGATTGGATATTCCTGATGTGACCCATGTCGTTAATTACGATTTGCCTTCGAAGATTGAGAATTATTGCCATCGAATCGGTC
GAACTGGTCGGGCTGGGAAAGAAGGTGTTGCGATCTCATTCTTGACCAACGAAGAC