Description :
From Genome Similarity Track
Location :
Scaffold_19:26140- 36486
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_19-snap-gene-0.56Ubiquitin carrier protein
Pytir_DAOMBR486maker-pir_contig_19-fgenesh-gene-0.24Gene of unknown function
Pytir_DAOMBR486maker-pir_contig_19-snap-gene-0.33Conserved gene of unknown function
Pytir_DAOMBR486maker-pir_contig_19-snap-gene-0.34Possible MAPK

Sequence
10346 bases(100 bases per row)
CTTGACGGCGTCTTTACGCGCCTTCCACGTGCTACGATAGCTGCTGGATCCATGATCCATCACAGTCTCAAGAGCTTGCTCCAGGTCCGAGCTCTTTGCA
TCGAACCGATCAATTTCTGCGACTGGGATCCAGTCGAACAATGGCACAATGTACAGCGACGCGGTCAACGTCGACGCCATCATCTGCTTCGCGAATCGAA
CTGCACTCTGCAGCGTTGGGAAGCACTGGTACACATGCACCGTCACGTTTTCGATCGCGGTTGCTGGGAGATCGTGAATGATGCTCACGCACGCAAACCG
CTGACCGTTACCGTGGAGCAGATCACCTGCTCGGAACTGATATGGGCTAGAAGTGGGTAGCGGCTCCGCTTGAGGTGCCTCGGTTGTAGGCTCCGTGGAA
AAGAAGTTTTCGAGAACCATGGTGATTTCGTCTTCCTTGTAAACTGCGAATCGCCCAGTGTCTTTGTCTGGCGGCGGCGTTCTTTCCAGCCCACAAACAA
GGCGAAAAACGTGCAGAGTCTCGTTCAGATCTCGAAATTTCCCAAAGACTCGGAACGCAATGACAAACTCTTCAGTTTTGGAGGGATGTGTGTTGGGAGT
GTCAGCATCGCTGGCGTGGTTGCTGGTTGCTGTTTTTCTCAAGTCAGCTGAGTGCTTCTGTCGCGGTTTCCTTGACGAACTGCTTGCTTTCGGGGTGGCT
TTCTCCTTCATATATCCAAGCAAACAGAAGGGCTGGCACACGCCGTGGACAGGATTCCATATCGCGGTCACACTTGTAACAGTAGGCACTTTTAATACCG
GACTTGAGATGTCGGACAGTTTGTCAGACTTCATAGACCTTGTGCTTTTGCGGTGACCATTGTGTCCAGACGTAATTGACGGGTTATGGAGAGGCTTGTC
ATACTGTAGCGGGGGCAAGGATCCTTCTGAAGGGGTTAGCATCGCAAGTGTTTGGCTTCTCGCCAAAGTTGAGTGCATTTGCGCTGAAACAATCGACTTT
CTCCGTGTTGCTGGAATTGGCTCCAAGCCGTCTCTCACGTGTACCGCTTCAGTTGAGGGCAAGCGCTGGTTTTGGCTGTCAGGAGTTATACCACTCGGTG
GCTCGCTTGGTTGTACGTCCTCATCAGCGATGCTGAGAAGGATCTTCTTCATTTCTTCCATTGCAGACAGCCCATCTGGATTTGCAAGCTCGGTCGCACT
GGTAGAGTGTCTTCGTGACATGTTTGCTTTCCCATCGCTGGGCGAGCAGTCTGGTAACGGACTTGGATCGTCTTCGTCAATGGATGAAGGTAGTAGCGAG
TCCGAATGCCGACGCTGGAGCTCATCGTCGACCGATTCGGGGCCAGCATTGCTCTTGTTGACGTCGGATCTAGATAGTTTTCGAGCTGGTTTCAGGTCGA
TGTTATTCTGGAACGAAGGGTTAAATCTGGCGCCTAGTCGGTTGCTGAAGCCAATCTTCGCTCGGTGGTCTTCTATCAACAAACATCCTGGCTCGACCAA
CTTTTTGACTAGACTTTCAGTCTGTAGAACTGGCATCGATGTAGATTTCGTCAACCCTGACGGACCTCGATCTGATCCGATTCCGGTTTTTCGTTTTGAC
GCGATAAAGTCCTCGAGGAATTTCTTTCGATACCGTTCCCAGGCAACAGTTTTCAGTGCGCGACTTTCGATGCTTTCTCGAATGAACCCAGCTGCTGAGT
GCTGGAGACTTTCCCGCGCTTCGGGTGACATGAGGTGAAATATGTCAAATCGAGACAGCACGAGTATCTTCACTGGCGATTCCGCAAACACCGAGTAGTC
ACGAACAAAAATGTCGTTGAATTTTCCTGCAGAAGCTCTGAGCAAGTAAATAAACAGCACAAAACAAGAAGGTTAGAAAACTCGAGATATACCAACACTT
GATTTCAGATGGAGACTTACTCGGCGCAGCCAATGATGGAATTTGGCCCGAATCGACCCAGCTCGTACAGCTGCGGCTGGTTGGTGACCGGATGTTTTCC
TTCATGTACCATGAGGCACTCTCCTCTCGTGACAATAAACAGTTCAGATGCTCTCGAGCCCTAGTGAGACAGTAAATAGTTGTTCGAATACTTTAGTTCT
TGACAACCAATTTTTCAAAACCAGTGCTCTCTCTCACCTGCTTGCAGACTTCACCTCGGTACGGAACATACTTCTCTGTCATGACTGAGCACATGCCTTC
AATCGTATTGTCGTCCCACTCTGGACCGATGAAGTACGAATTCTTTCGTAGTAAATGCGCGTATTGGGCATGGTACTCGTTCTGGTACTTCTTAATTAGC
GGCTCATACTGATCACGGCTGAGCACAAGCAGCTCACAATAATCTGCACATTTCACAGTCGCTCGCCGGATGCCGTCTACCTCGGAGAGTGCGAGCTCGC
CGAAATACTCGCCTTCACCCAACCGAGAGACGACGTTCTCCGATGTTTCTCCAAAACGGTCTTTCGATCGAACCGTGACTTCGACGCTCCCAGAGAAGAT
GATGTAGAAATGCTTTCCGATTTGTCCTTCTTCGAACAAAACCGTGTTCGTGACTGCGCTGATCAGACGCATGGCTTTGCACAGTTGTTTCCGAACTTCG
AACGAGAATCGCGAAAAGAATTTCACGCTCTTGAGGTACTCGACCGCGAACTTGAGATCCTTTTCGGACCGCTGAGCTGAATGACGGACGAAAATGTTCC
GGATGATATCTTTGTTGGAACGGAATCGCTTGGTGATTTCTAGAGTATTCGACCCTGCTTCTGCCTCTTGAGACTCTTTTAGCAGCTCTTTGAAAACGGT
TCGACTGATAAAGACAAGCTCCACGGTATCGCTCGCAACAATAGCCGATGCTAGCACGAAGAAAAAGGGATACATCGTCCATCAGTAACTTCTACAACGA
GTATGAGGATCAGTCGCGTGTGTGCCTACCTGCTCGCATGTCTGCGTCGGAAAGTAGAGCTCGTTCGCCGAAAGTGTCGCCTGATTTCAGAAGTGCAAGA
CGTAGAATCGAATCGGAGCGATTTGTCTCAGCAGCAGCGTCGTCATGGCGAACGATTTCCACTGGCGATGAGAGCAGCATGGTAATGAAAGGCAGTGAAT
CAGCAAACGGGGTCCGTCCAGTCTGTTTCACAAGGGAGGAATGAGTATATGTAAACCTTTTCCGGTGTACACCAAGCAGAAATTTTCTCCGGGATCCCCC
TGTCGTGCCGTCATCATCATCATCATCAGACAAAAGTTAGTCGGACATTACTTCTTGCTTGTCAGTCAACAATTCAAGACAGTACCTCATGGAAGATGTA
CGCCCCTTTTTCCACGAATGTGATAAACGAAAGCGCTTGGTAGAGCCGATCAATCTGTGCGCATTTTTTCACAAACTCAATTAGGATCTGGTTGGTAAGC
GTTTCAAATATGATAGGCGAAGGCTCAGGTAGAGAGCTAGCGCACCTTGTCTACAGACATTACACAGAGCACACAGCATTATTAAACTCCGCATCAACAA
CAGATCAAGGCGCATTGCATAGCGTCGTGAAAGTGCTTGCTTACATGCATCGAGATTCGAGAAGAAGTCGAGAAGTCTGGACGCTGATAGTAGCGACTTT
AGCTGCGTTGAGCCAGAACGAAAAGGCAATAAATGAGGAAAATATGCGTCACGCCATCACTCGCACCCGAATGCCTAGCATGGCATCTATTTTGTGGTCC
GTACCATGTGGATGTCGTCAAGTGTACGCTTGCCCAGAGGTTTGAGCAGGATGCGCCGGCAGGCGTCCACTTCAGGACGGTTCTCCTTGACCGCCTGTGC
GAGCGCTCCCTGCTGCGCGAGGTCTTCGAGCCGCGACGCCAGCGACACGCGGCGACTCGCTTCATCTGGAGCGCTGTCTGTAGCAACTTTGCCACCAGCG
TCTGTCTGCACAGCATTGCTCACGACCGTCACTTTTGCTCGGCGCAGCATTCTCGCTGTGGGTGCGTGAAGAGTGTGGCAAATATAGCAATGCGAGTAAC
GGGATGCGGAAATGGCGGGAGTTAAAGGCACTTCAACTTCTGTTATGTTGCTAAATGCCAACCTTGCTGCAACATTAACATTTTATGGTATGTTGCTTTA
ACGATTTTCATCTGTCTGTCAGTCCGCATTTCGTTCTTCATTCACTTCACAAGAGCGAGCAAGCAAGCAAGCAGCATGGAGAAATGGCGGCAGCTCGCAG
ATGACACTAAGCGGGCACTGCAGCAGCAGTTCCTGGGTGACAAGTCCGTTGCGCTCTACGAAGCGCTGGGTTCGCATGTTGCCGACGCATCCACAGGCGG
TGTACTCTTCTGGGCGGGCGTGTCCTCGGCGCAGATGGCGCAAAAGGCGCTCCGCATTGGTGCTGCGACGCCTTTGCTGCCACAGCTTGTCGGGGGTGCC
GCAGTCGCAGCGTCGTCTGCCGTGGCGCTTCACTTTGCGTCGCTGCCGCGCGAGATCTACGAAGATGCAGTGCTGCAAAGGACTCGCGACGCGGAGAGTA
AGCTCACGAAGTTTTGGTCGTTCTGGTCTGCTTCGACAACGCAGGACCCTGGCCTTGTGACCAATGCCCAGCAGAAGCTAAAGTCGCGTGTTGAGGAGTT
CCGAGACGCGCCGTACCCAGTGTATATGCTAATGGGGGTGCTCTGCTTCAAGATGCTCGGTGGTAGGATGAACGCAATTGCGCCGAGCAACTTTTCGAAC
TTGGGGGCGTTCCACTTGAAGAAAGCGTCACTGCCCGCGACAGTTGAGTACGCGACGCCAATCGAGCGCGGCGTCATCCAGGAGTTTGGGCGACTCTACG
GGTGCCACACATGTGGTGTGAAGCGAGGGGTCAAGTATCATGCCGACCACATGCCGCCAAAACTGTAAGTGGCCGTGTTTCGATAAAGCGAGCATGCTGA
GTCTTGATAGCTGGGAACTGACTGATTGTGACGCTGTCCTTCGTATTTACTCTGCACCAACAGTGTCGCGCAGCGCATGAACCAGAACATCTTCCGACGG
ATCATTGGTCATAAAGTCGCGTTTCGATTCTACCCGCAATGTGAGCCGTGCTCGAACCAACAGGGAACGGTCGTGAAGCAGTGGAAGACCAAGCTGAGAA
CGCATTTCCTGTCATTGCGACTCTATCACAGCACTGGACTGTGGCTTGTGTTGCTCTGCACGGGCGGGCTCTACGTCGGCGGCTCCAACTTCCACGGTAA
GAATACACTAGCTCCCCTTCATGACGTCCATTCATGTATCGTTATCTGACAATTTCATTGTATTTCGCTCCACAGAAATGTCGGATGTGGCGTCCTCGCA
AGCAACCGCCGGTGATGAGCTGCTTCAATACATGAGCCATCACGCGACATCGGAGCAGTCGCTGCTTGTATCACTGCGTGAGCGAGAGATCAAGCTCCGA
CGACAGCTGAGGAAGGCGAAGAGCGATTCACCTGAAGCTGCAGCAATCAATGCCGAGATTGACTCAATTGTTCAGTGTAAGAAGTCTCTGAAGGCAAACA
TGAAGCGCCAAAAAGCCAGCCAAGCATAACTACGTGGCTGAATTGAGAGGTATCCATAGATTTTGTTGCAGGAGACTCAGAGACAAGAGTCAGTGTTTCA
GATTCCTCAATGCCAATAATTCGCCGATGCCAACGCTGATTTACAGGTGACGCAGTGTGGGCGTGTGAGACACAAAATATTCAAATTCATAGAGATGCGA
ATGGCGAAACGGTAGACATGCGTTTCTCGTTCTGTATTCGTGGTTGTGCGGAGTTCCACCTATTTCGGGTCCGTTTGGTTGCTGGATTGACAGCGCTCGG
GAGTCTTTTAGGAGCTGGCAACCTTGCGGGAAAGCGCTCGCTGTGTCAGGACGATGACCACTCCAAGTTGAGAGAAACTCGTAAAGAAGCTGCTGCAGCA
ATAGGAAGCCTTGGGTAGAGGGATGAAGAAGCGACGCCACACATCGATGCACCCTTCGCGCGGACAACGTCTTCAGCAATTGCCATCTCCGACAGAGCAG
CAGTTGCAGCAGCGAGAGAGTGGGTGGAATGATCGCTTCTTCTACGAGCAACCGATCAATTCCAATAAACTGCCGCGTCCCGATCGGATCACGGCCAACT
CGCCAAAGCCACCAGCTGCAACTGCACAGCACAAGAGGGAGAAGAAAATTCGCGATGAGCGATTGCAGTATGGTAAGGAATATGTGAGCACTGAGCACAA
GGCGGTGGATGGATATTGAACCATTCTTCAACACGTCTAGGAAACAACGAGGTCAAGCGCAAGGTGAAAGAATCCAAGCAGCCTACGAATGGGAGGTTGA
TGCCGCTAGGCTTTTTTCCTGAGTCTTCAATGGTGAGTTCAGTGAAATGCCATCAAAGAGATAACAGACCAAATCCTGACACCTAACACCTGTTTATGCT
CGCTTTGTCACTTGTAGGAAGGAAAGCTCCACTCCACCAAGGAGGGAAAGCTCCGACTAAAAGCACTGAAAGCGATTGACACCCGCGAGAGTCTGGTGTA
CCAGCTGAACGCACTGATTCTGTGCACACCAGTGCAGGAGGCGTTGTTCCAGCCATCCCGCCCAATTGACCCTTCGTCTTCATCCAGCCACGGGTTTCAA
AGAATGCGCGCGAAAGCTGGGATGGCACTCGCACCGACCCCCTCAAGCCGATCCAGCACCTCTGGACTTATGGCAAATGCGCGCGAAGCCACGAAAATGG
CGCAGAAACTTGCCGAAGATCTGCAGCTCGCAGGCATCCAGTGCGTGGAGGCCATTGTGGAGTGGATGCTTGAGGCTGGCGCCAAAGCTGAGTAAGTGAC
TCTGACTTTTGCATCCTGGAGGAACTGAAATCTTATAACGGATTGTCCTTCTTCACAGAAAGCCTCCTCCATTTGTGTGGCGTGAGCGAAACTACTTTCT
CAAGATGCACCATGACTTGGATTTTGCGCAACCAGAGCTAGAGGCGCGTGGGATTCATCTCGAATGTTACACTCAGGGAAATCCGCTGCTGATACGACCA
AACCAGAAGCTGGGTCGTGTTTTGGCAGCTCAAGCGATTGTCACAGAGATGGTGGATCTCGCTACTACGGCTAGAAAACCGTCACACGAACTAGTGGATC
ATGGGTTTGAGAGACGTGTCGACGACTCACACAATCCGAGCATTCAGCAGTCCGAGAAATACGTTCTGGAGCCCGAAGACCAAGAGCTCAGGCTCAAGCC
CAGCAGTTCAGTCAAGATTGTCTCTTCCGCACAACAGCAAGAGAGTGCTGACATGATGATCCTACAGGTTGCTGAAAACGAAGAAGGTGGCAACTCGGAA
TCTGAGCAGAACGAGGCTGAACACGACGATAGGCAGGACGACGAGTACGAAAGTGAGCTGGACGAGCACGACATCAAGCTCCCGATCTCGAAAGGGCATG
GACTTGACGCGTCATTTGCAGAGGAGCTCGTGAACATCCTGGATGAAAGCCTCAGCGATTGGGTGACACCGAATTCGATTGCGCCAGCAAGTGAGGTGGA
AAGTGGCTTGACTGTGCTCACGGCGAGAGAGGATGAGCGTCTGACGTCAGAGTACGACAACAGTTTTGAAGACGAGGCTGGCGAACAAGACGAAGCAAAA
GAACTAGGACAAGAAGAACGAGAAGTAGAAAATCAAAGCAGCCATGACATGACAGAGCAAACCATGGCAATCATCTCAGCGAGCGAATGCAATGAAGATG
ACAAGGGACCAGCCGCTTTGGATGACAAGGAACCAGTAGCTCCAGAAGATGGTGAGCCAGGCAGCAACGAGGAAGAAGAGCCAACTTCCGCCCTCGAAAA
AGACAATCAGAGCCCCGAGCTTGACGAAGCGAATCGAATCGAGGCAAAAGATTCCGCCGTTACTTTCAGTTCTGAAAAAAGCGAGTCAGAGAAGCTGTAC
GAAAGCTTGCTGACAGAACTAAGAAGGCTCTCTGAAGCCGAGGACGTAGGAGCAATTGACGTCCAAATCGCCCACGTCGCGGAGTGTATGTCCTGGGAAG
GAGGCGGCGAGATCATGGCTGCTCTTGCGAACCGTGGGTCACTTGGCCCAGTACTAGAGGGCTCATTTTTCTCCGTGCTCGCTCAGTTTCAACTTTTGCC
GTTGACCAAGCCGACAGAAGAGCTGCTGCAATCTCAATTGGCGAACGAAACTCAGCTGACCAGTTCCATTTGGCGCGAGTGCCTGTGCATTGCCGATAGC
ATGTACGAGTTTCTGGCGAGTCAGATTCAGCTTGCTTTGGAGAATGGGAACTCGTTGATCTCAGAAATCGAGATCGACGAGGCGATCGAATTGACAGAAG
GCGTGTTCACCGAAATTAGCAGAGCAACTTGGCTACATCTGAGAACTGCAGTCGAGTTTCTTAAGTTGATACACTCGCTCCGTCTGTCAGATGTTGGGGG
CAAGAAGCGTTGCGGCTCGTCAGGTGTGAGCAATATCACCAAGTTGTTCTATCCATACCTGGTGAACCTGCCGCGAGAAAAGCTGTCCTCCAGTTGGCGG
CAAATAGCGCAACTCTTTGAATCGATTTCGCCAAATCTGAACGATCTGACATTCCTGATGGATCCGACATGCAAGACTCTTTTGCTAGCTGCAAGCGCTG
GAGGCAGCCAGACTGACGGCTCAGAGAGTGAAAGGGAACCAATGGCCTTCCCAAAGCTGACAGTTGTGTGCGAACGCGGAAATATCCTGGAAACGAGTGT
TGCTGCTCTCTGGACCAAAGCATTCGCAAAGTCAAGTCCCCAGCCCCAGTTCGTTTTGTACCCGTTCTTCCAGTCTCCATTTGGCGAAAAGATCGTTGAT
GGGCTTCGAGTGGAGGAAGGGGAGGGCAAAGGACCGCTGAAAGAATGGGTTACTCTAGTCTCAAGCGAAATGGCTGCAAAGTGGAAAGATGTGCCAATTA
ACGTGTCGTTCCATGACAACGCGTCAGTGGAAGCAAATGGCAACAGGCTGACTATGTCGAGCTTCATCCAGAACCTGAGACCTGGGTACGAGATTTCCTG
GAGAGTAACCGACGAAGAGAGAGTGACTCGGATTGTGAACAAGATCGTTGATCAAGACACTGTTCTACTTGATCGAGGGGTCTCAACTCAGTCATTCCCG
ATCGCGGAGCTCAAAGTTCGACAGCCACGGCAAGCGTTTCTCGAGTACATGAAAGCGTCCGAAAGCTTTTGGCTCAGCGCTCAGACTCCAGACTCTCCCG
AGAATCACCGAATATTGCATTTCTACGGCTGGTACCTGGCGAGTGCTGTGTCACACTACTCAAAGATCGACCTTCAGTTGCACCCGCTATTTTTCTGCTT
GCTGCTAGACGAGAAGTACCGTGTTACGTTGGAAGATGTGAATTCCCTGGATTCGACGCTATACGATTCGCTGATCCAGATGAAGACGATGTCGCAGGCA
GAGTTTGCGGCGTTTCTGGAGCTTGAAGGCGGCGACTCGTCTTTGAGCGTGGAAAAGTACATTTTACAAGTGGTCGACGAAAAATTTGGTACAAAATCAA
ACATTTGGTGGCAGTTTGAGGAGCTCCGAGCAGGTTTTCGACGTGTGTTTTCGCAAGACGAACTCAATGCAGCGGGTATTGGAGCTGAAGACCTAGCTGA
AGTTCTCTGTGGGAGCGCACAAGAAGCGGTGGATCAGAATGCAGATTTCACCATTAACGAGATCTTCCGAGTGGCGCTGGATCCCGATTTCATCAAGTGC
CTCCCTCTTCGGAGAGTATTCTGGCGAGTTGTGGACGCATTCGATCCGCAAGTCAAGCGAAAATTTGTCAAGTTTGTTACCGGAGTGGACACATTGCCAC
TCCCAGGCACAGAGGTAAGATGCATTTGCAATGTGCTACTCTGTCGTTCAACGTTGCTGATCACTGACTTACATTGTGTCGCCATTGCAGTTTCTGCGCA
TCGAAATGCCATTTGCAGCACTGACCCCCGCGGAGAACCAGAAGATCCTGCAGATGCTCCCGCAGTCTCATGTAAGTGGTTTTCTTGGCTCATTTTGGCT
GCGATTAACGATTTGGTCGACTAACGCTGGCGTCTTTTGTCAGACGTGCGATAACACGCTGGAGCTACCAAACTACTGGCGAGCGCTGTGCTGGAAGTCG
CAGCATGATGAACATCAAGAAAGCGAAACGCTCGAAGAAGAACTGACGGGGTTGCTGACAAAGAAGTTGCGGGACGCAGTAGAGTACTCGAGTGGGTACG
GTTTGGACGGAACGAGCGCGATTACTGGCATTCTCTCCGAGAAATCTGGGAAACGACCTGGAAGCTCAACGAGTCGGAGCGAGTTTGCGAAAGATGAAAG
CTATGACTCGCTCGACCTCCCTGGTATAGGGGATGATGGCGAGAGC