Description :
From Genome Similarity Track
Location :
Scaffold_181:2614- 4154
Transcript NameFunction/comments
Phyag_g3158hypothetical protein PHYSODRAFT_551984

Sequence
1540 bases(100 bases per row)
GCTGAGCGTTCACCGGGGCGCGGTTCGCGTACATGGCCGAGTTCTGCTTCCGGATCGACTTGAGTCTACGATTGGAAATCAACATGCCGATAGCAGTGGC
CACCACTGTGAAGATagtcgtcgctgccgccacAGCAATCCAACCCGACGGACTCAGACCCACGAAGACCTTGTCACCGCCGCTATCAACACTCGTAGTC
GCCGCAACTCCGGCCTTTGCTCCTGTGGGGATGACGGGGAAGATGTTGAGGCCGCAGTTCACCTTGGAATCCGCTACCAGCTTCATGAAGCCGCTGGCAC
CCCACGAGCTTCCGTACGAGTTCTTGAGGATCCAGTAGTCACCCTCCGAGGCATCGGTGCCGTAtcccacgagcagcagcgcgtggttCACGTCGTCCTT
CGAAGACAGAACGCCATTGTTCGGGCAGCTGTAGAAGCCACCCTTGTAGTCGCCGAACGGGTCCTCCGAGTTGATAGCCACAGCAATGggctgcttctcc
agtgccGTACGCAACAAGAttgtgcagttgctggacgCTGTGCAGTCCGTTCCCACAACCTGCTCATAGCCCGTGATACTGGCCGCTGTTTCATTGGCAC
TCactgagcacgacgacgacccgtTATTTGTAGTCGTGCTCCCGGAACTAGAGTCGTCGTACGGCATCGTGAGCTCCGTCACCAGCCCCCAACTATTCTG
TGCCGCGTCGATGAAGGCCCCGTGCGTCATACCTCCATTACAGCCGTTGTTCTGCGACTCCCACTTGATCTCCGTCTGCATCCAAGTAGCTCCAGTCACA
CCGCTGTCCGAAGCCCAACAGTAGTCGAACGTTTGCGTTGTTTCGAGTGTACTGCACGTCAAGAACTGCTGCGGGGAGAGCGACACAGCCGCCGACGCGT
TCTCAGCGATCACGACGGCCGTCTCAAtggcatcagcagcagcaaaagcccAGCAACTGCCGCAGTTCTGCTGACTCTTGACCGACGAGCACACGCTGTA
GCCGAACGAATTGTCCGTGTCGCACCAGTTCCAATAGTCCGAACTGCCTGCACTTGACACCGTGTTTGAGGTtgtggcggtgctgccgctggccTCCGAT
ACGAGACGACGGGAGTGCGCCGACTTGACTTCCTGGTCGACAAGCTGTTGCGGCGAGAGGCGGCGCCTAGATGACGACGTCAGGTGGCGCTCATTCACGC
CCAACTGATACGAGAACTCGTGGCCCACGCTCTTGGCGTACATGTGCACGTCCTCCAGGTACGTCATGTGCGTCTGCAGGTTGCGGCGGTAGACTTCCCG
GTCGCCAAAAGACACGATGTTGCGCTgtacgagcagctcacgtaGAGTCTTCGAGCTGACGACTTCTCCGTTCTCTCCCGTCCAGAGGCACGGGGAATCG
GCCGAGCGCTCCACGGGGCAGTCGACGAGAGAGCCGAGAGAGCGGTCTGCAGCATGcgcggcggaggcggcggcaaAGGCCGCGGAGAGCGCGAGGAGGG
ACGCTTGCACGCGCATGACGAGCTATGAGCAGAGGGATAA