Description :
From Genome Similarity Track
Location :
Scaffold_37:26139- 27484
Sequence
1345 bases(100 bases per row)
ACATTTCGACTCAATTTTCACATCGCTTGTCAGTAAACAAAAACTCAATCATCGCTTGCAAAATATCAATCATTGTATTCGCATCGGACCTGCCGCGCTC
CACACAAATATTGAAAAAGTCTTCTTGACAAATGTCCGAGGATACCCTCGATGCAGTCAGAACATTTGCATAACTATATATTTAAGCGCATCCGTAACAT
TAAAATTTTCCTGTGTCATAGCCAACCACACTAAGACCTACAGCTCAGAGTATACACCGCTACAGTCTGGATATCGCTTGATTGCACGAGCAGCTGGAGA
TACCAATTGACTAATTCAATCTCACAATACACTGTACAGCCTTCTATTTTGTACTGAAAAGTACATATCTGAGGAACCTTCGTTTGTGCTGAAAAAAGGT
GGCCCCAATAACCTTATCGTAAGCAGAAAAATAAGCCACTTTCCACTAATGTTTTAAACAAAAATGATTGTGGTCAAATGCGGATGTTTACCCTCATGGA
CCATACCCGCTTTGCACTAACGGATATATCGACAATGCCACAGTGTTTTTTGTAAGTCACTGCCCTGTAATGCAATATTGGGATCAAGAAACCAAGTTTG
TAATATGGTGTACAACTTTATCGAAGGTAAGATAGACGATGGATCATGACATACCACATCTTGGAAGTCCTGTACTAAGGGACAATATAGATCGGAAGAA
GTTCTGGGGATCGATGATTCTTAAATGCGTTACGTCTAGTATTGGTGTGCTAAAGAACAACTTCATCCAGGAGAGCATTCAACCTTGACAGCAGGTCTAA
CAAACACCATTTATGATAGTATTTCAGCATCTTTCCCCGGTTCAACTCATCAACAGTCATTTCATCTAGCTCTAAGCGATCGTGCAACGATGGTGAAGCA
TCAAGTCTACACCATTACCAACACACCATTCATTGTATTGAGGATTGTATATAGCTGATAGCTGGTATCAACATGTGTCGAATCATCCACCTAGCGTTTT
GTAGCAACCATAACGGTATGCTGCCATATTCTGCAGAAATCGTACGCCTCAACGAGGTCGGAACCGAAATGTTACCGAATTTAATATGTCCACCAACTTC
ATTTTTATTCATTAGGCGATACCTTCACCAATATTTTTTAGTGGTGAGTTACGTAACTCACACCTACGAACAAGTAGATTACTTGTCCCTACACTTGCAT
CAATCGGGGATAGATATGGTTGCCTTCGCATTTCGCCGACACAAAATTTACTACATTTAGTGCGTTGCTATCACAAGCGAAGTCACTCAGTGTATTCTTA
CAAGCCACCCCACGGGTGCCGCGTCTCATGACTCGTCTCTAGGAC