Description :
From Genome Similarity Track
Location :
Scaffold_74:261379- 265432
Sequence
4053 bases(100 bases per row)
ACCTCGGTGTTGCCCTCCTGAGAAACAAGACGAGTAATGCATGGTGATGAGCAAGGTGCCGATTATTCAAGAAGAAGATAAGCTGACTTACCTCCAGCTG
TTCACGTTCACGTCGTCGACAAAAATTCAGACGCTGGAGCGCGTTATTTACGGCCCGATTGAGGCGCTTGGACATCCTGTGACTGGATGGTGAATTGAAG
AATGAATAAATGTCACAGCGGGCACCAGTATCGTGGCCCTTATTGCGACATGGGCTGTTGTGGTGTAGTGATTTATCCAGAGTTGCGGATAATCGCCCGT
CGACAAAGCTGCAGCACCGCCCAAGATGTTTATGCGACGAACCCTCGGTCACGTGATGTACGGTGACTCCAAGGTGCAAGAGACTCGACGGCGTCACTAC
CGAACTCTCAACGGATATTGGATACGGTCCAGATGTCACTGAATCCATGATGTCCCTATTATTAATAATGAACTGGCCATATTTGCATTCAGCGGCCAAG
AACTGACCATCTACGATACGAACCCGCGGTGGCGGTTGGGATGTGTTCGCGGAAGACTCAGCGACCCTTTGAAGACACGTTCACCGTCTGGGACATGACG
CGAGCCGTTAAAGATGCTCATGCGACGGTGCAGACGACGTTTGGCGTGTAAGAAGATCCATAACGGATCATCGTTCACTTGATATTTGTATACTTGATTA
GGACTTCTTATTGGGAATAGACCCGAAAGAGTAAACATAAATACAGAACAGAATTTCCACTCAAGCACACAGAGCGACGTCCGGCTTCAAGGTAAGCATC
TGGTCAAGCTTGTTTGAATGTGTTATGCCTGTCGGTGAACTCGAAGCTCTGTAGCGAGGGTTCATCCGGCAAGGCCAAGAGACTGTGTGTTTTGGCCGAT
TACTATCGGGAGGTTTTACGTGACGGCTTATTGTTGACTATTTGCACGACTGGGAGTGCTTGTATTGTATCCCTTTTATTCCTTCAACCGAGTGTTGAAC
ACTCGGTGCCCTCGTAAAAGGCTTGCCCGTGCCTGCTACCCTCCCGCTGTTGGGACCACGAGGATATATATAACACCTACTAGCTTTGCTCGTGCTAGTA
CTGTGTTCTTATTTTTACTGGTTGGCCTATAGAAGTTGTTTACAGGGCCTAATCTGTCCCGGTGCAAGCGCAGAACTGGGGCCTTCAGGTCCGCCCGAGC
GATCGTTTGCTATCCTAGCAGACGTATTGTTGTGGGAACGTCCTAGCTACATTTGTAGCTAGAGCTCACGTGGGTATTCCAACACCACACTGGACATGAA
TTATATCAGGCAACGGCAAAGCACAAGCGGTTGCCGTCCAACATGGTAACCTTGTGGTGGGCGTACCGCACCATAGGTTAGTACATGGTGTCGATGGGAG
CCACCTACACCACGACTGAGTACCGTCACGGTACACGGTGTCGGTGAAGGACACCTACGCGGCGTTGGTATGACGACCAAGACGCGAAGCGAGCGTGACA
GAATCTCCACCCGCAAGAAGGAATCCTTGCTGACGCCAAATGCATGGCCCAAGGTGAGCTGAGACCTTCCTCTAGTGCTCGAGCAGGTGTTTTTCTTCTC
GGTGTAGTCCCTCGCGGGAAACACCATGTTCCGCACACGTTCGCAAGGCCTGTTGTATCCTCTAATGCCAGCTGTCGGCGAATGTCTCGCGCTCGGATGC
TATTGCACCCCGTGCCAACGCATTATGCGCGCGCAAGCGCAGGAGCTAAGGTAGCTCTCAGTGTAGTCATTTGCGACCAACAGAGTTGTGAGCAAAGGTA
TGCAAATCCCAGCGTGATTTAAGTGCACAAGTCACTAGTGGTGTGACTGAGATCCGCGACAGTCTCGTGGCTGCTCAGTGTGATAATTCACCTTCGGGTG
TCTTAATTATCTCACTTCTGATTGGAAAATCAGCTGTGATTAGAGAATCAGGTGTTTCTCTGTTAAGTGGAGGATGTAACGGGGTACATTCCAGTGTACG
TCAGGTAAAGAGTGACCGGTCACTCTTGTGGACACCTGGAACAAACTACCAGGTACGCTAGGTGCCAGTCAGAGCATGGCTACTTAGCTCCACTAAAGGT
AACCTTTAGTTTGTATAGAGCCCAAGCTAAGATGAATTTCAATATATATACTCTTCTAAGTAGCAAACCGTTTCCTCTGAGGCCGGGAATACGTGGACTA
GCGTTCACTCGGGTAGTAAATATCCTTAAGCACTTCCTCTGTGCAAGGTGCTGTGTGACCCCGTCATATGTACTAAGCGTTTGCTAGCTTTCCGGGTACT
CTATACCCTGTGTGCCTCACACCGTGTAACCCCATTCCTACTGCTTGGCATGAATATATATTTAATTCTGAATATGAAGACCAACCTATAAACCTTACCG
CTGGAGATGATATCACAACCTTCTTGGCGCTACTAAAGTCGATTCAGGCTAAATCGAAGGTGTGGACCATAGAACAATCGTTAGGAAGTAAAACGAAATG
CATACAATGACCCAGTTGAATATACCAATTATATTTGTGGTAGGCCACACAATCACCTTGCACAGAGTAAGTGCTTAAGGGTTGCTCTTAGCCACGCCAT
GCCATGCCATGGCACGAAATGCTGTGATTTGATTGGATGAGCGCTCGCTAGGGCTAGAGTTTAAAGTAAATAAAATGGCAGGAAGTGCATTTGGAAGTGC
CAAGCTACTTTTATCTTCAATAATGTATGTATTAATAAACCGTTTTGATGGTGGCACAAAAGGCAGGGCAATTCTGTTCGTAACCACGCATGCCATGGCT
CAATTTCTAGTGCCATGGAATGGCACGCGTAGCAGTTGTTAAGAGCCATCCTAAGGGTATTTATTACCCGGGTAAACGTGATGTCACGTGCTGTCGTCCT
CGGAGAGAACGGTTGTTTTCGCTACTTTGAAATGTAGATGTAAGGCTGAAGTATTATTGGGTGCTAATAAGAGCTAGAGATCACCTATTGTAAGGGAGTG
TAGTTATGCACTGGTCGGCGCTTAGTGATATGGAATAATATAAAAGGTATTCGGAAGGGTGATCTGTCACAGTGTTGTCACTTTTCAGGTAACTTGGGTA
CACTGGATTGAATACACTGCATTAGCCCCCCCCCTCCCTCCCCACGCACACACACTTAGCTTGGAATCACCTGACTCTTCAATCGCAGGTGATTTTTCAA
TTTCGAAGTGAGAGAATTTAAAAGTATTTTTTTTCCCAAACAACCTCGATGATATCGCGGCTCTCCGTCACACCCACAATGATATGCATGCCCACTCTCC
CAACTTGTCGGTCGCAATCGTAACACCTACAGCAATCTTGTATCTTGCGCGAAAGCGCGTACAGTGCATACCGCTATATCCGGGTGTGGTATTCGACCTT
TGCTCGCACCGAAATACACGCCAGCTGTGACGGGGTCACACAGCACCTTGCGCTAGAGGAAGTTATCTTCCGAGAGAATACAAACTCTCAGTGAATGGCA
GTTCACAGGTCCCCTCTTTATTTAAAAGAAAGCGAAGTGACCTAAATAAGGTAGATTGTAAACTGAGTATATTTATAGGTAGGTTAAGTTTGGGTTTTAT
ACAAACTATAAGTCACCTATAGAAATGCAATGTCGTTGACCAATGGTTGGCTTTGAATGACCTTGGTACCTTGTACCAAATATCCCGGAGTATGACGTGT
CATACTCCTGAAGTGTGAAGTGTCACACTTCATGTAACCAGGGTACACTTAGTGCTACGTACCCCGTTACATCCTCCCCCACTTAGGTTCGGTTTACCGA
CCAATCAGAATGAAGAGGTGTTCGTCACAAACTCTCATTCTCAAAGTCGAAAACCATCGACTTGGCCGCGCGAGCGCGGCGGAGGCTCACTTTACAGTTA
GAGTCTCGAGCAGCAACCTGTGCGCTCTTCGTCTAGGTCTCCAATTCGACCGTTACCATGCCTCGTGGCACGCAAAGAGCGGTGCTAAGACACGCTCCAA
GGCTGCAGCCGGTAAGGCGCAGGCCAAGAGCACTAAGCCTCACGGCAAAGGCT