Description :
From Genome Similarity Track
Location :
Scaffold_208:26136- 29021
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_208-fgenesh-gene-0.5Phosphatidylinositide phosphatase SAC1

Sequence
2885 bases(100 bases per row)
ATTTCATTCTCCCTTACgCGCCTTGCTCTTCTCCCCGTCGCGAGGATGAGGTTCACTATTCCCAACTGTTCTGACACACAGCACTCCGGAATAACGTCAT
ACCCGTGATGTGCATGCTGAATTAGGAAACGCCTTTTGCTGGCGAACTCAATCCTGTCAGCACCTTTTCCCCGCAAAAGCGTTCTTGACCATTCCCAAAA
ACTCGGGTTCGGGTATGTGTACAGAACGGTTGACTCTTCGGAAGTCACGACTCACCTTTGAGACGAGTTGAAGGCTAATGGAGAGGCGTACCTTCACAAG
AAGGTCGCGGTTCCTTAAGTGTAAACTGCTGCTcctAAAAgACTTGCTTCTACCACTCAATTCCTCTACTCTTCTAGTGAAAGTATATATGGTAAGCTTC
AAGGAAGAGTTCTCGACTACGCGAGTTCAAGGAGCTCTTGACcGTCTTGCCACCACTTGTCATCCATGATCACAAGGACAACCTGGCCgCGCGACGATAA
TGCTGTAATCCAGCCTCCGGATTCCAcGTgcACCATTGCTGTTGAAGTGCTCGATTCGCTCCCCATTCGGATTTGAGATCGAGGATCAGACAGCTCTGTT
CACGAACTGTCGAACTCTCGGCTCCATCCCCCTTGCGTTCACACGAGCTCTATCAACCACAACTCATGCGCACGATCTATCAACAAGGaCGCTGGACGTC
GTCATCATGACATGACGACCATGCCTCATCCACACCCAGTGTCCAGTCCACAAACAGCTCAGCCTCAACGATCCTACATgcATCACAGTACAGTGTATTG
AGGCTTTTCACGCAGGCCGTTTAGGCGCGCATGTGCTCGCACCAACATCTCACTGGCGTTCTCAATGTCGCTACGACACAGGTCCAAAGCCCTTGGAGGC
TCCAAGGGCCTTGTCCAACTTGGAACCAAcTCCCATTGCCACTACTGTAGAGCGTAATATGACCTTGTCGCAAGCCAATCACGGTAGAAACTCTGTTCCT
TGGCTGGGGCAGagTCTAATCATTCCGTGTCGCTGGCTGAGCTTGATGAGTCAGGTCTAACGTCAGAGCCATGGGGTTGTCTATGGCGGACCGTCGTGTG
CTGGCCTCGGGGCGTCGTAATCCGTCGTCATGTCCCACCCCGGGTGCAGTGTCCGGTATTCGGTGCATTCCGAGTTTGCATCCCCcTAAAAacACCACCA
AGCTTTGCTCTCGAATCTATTTTTGTATGGAATCAGTTCCAGTGTGTTGTCAAATTGGGGACGAAGAGAGTCGTTGCATTGTGACTGCCGGGTAGTCACG
CGTCTCACCTCATCCAGCGTGCGATTGCCACGAGGAGCTACGCCAGGAAGCCGAAGCAGGCGGAAGTCACTCGctcTCTCTCTCTCTCCAGTATGTTCAA
GGTGCACGTCGAGAACTCGGAGCTCCTGCTGGAGGACTGTCGCGCGGGCGCCAGCGGATGGCTGCGGCTCTCGGTCGCGCCGCCAGTGGCCGCTGGGTCC
GCGAGCGGTGTtGACATCGAGAGCATCGCGAGCGTCTCGGATGATCGCCATGACCCCGACTGCATGTCCATCCACGCCGTCTACGGTATCTATTCGCTGC
TGAGTGGCCCGTATCTCGCTGTCATTAAGGAGGCGAGGGTCATTGGCTCGGGCCCAAGCTCGGAGAAGATCTACTGCATCCTCGAACTTGACCTCGTGCC
TGTGAGTGCCGCAGCGCAGCGCAGCTTCTTCAAGCACGCGAGTAAGCGCGAGAAGAGCGACGAGCTCGAGTATGTGCGCATGATCAAGTCGGTCATCGCG
TCGCGCACGTTCTACTTCTCCTACGATTACGACCTGACGCTGTCGGCGCAGCGCCGCGCGAGTCACTACACAtcGACCAACAGCCAGAAGCTGCCCATGT
GGCAGAAagCCGAGgAAGACTTCTTCTGGAaCAAGCCCGTGCTGTCCAAGTTCATTGAGCTGCAaCTGCATAGCTGGATCGTGCCGGTCATCTCCGGCTT
CGTGAAGGTCATGAAGAAGTGCGAGATCAACGGCATGCGCTGTGATGTGCTCTTCTTCACGCGCCGCAGCTGGCGCCGtGTTGGCACGCGCTTCAACGTG
CGCGGCGTCGACAAGGACGGCTGCGTCGCCAACTTTGCCGAGACCGAGATGCTACTGGTCAAGCCGAACCGCTCCATCTGCTCGTACGTGCAGATCCGCG
GCTCCATCCcGCTCTACTGGGACCAAGTCGTGACGCTCAAGTACATGCCTCGCACGCGCTACGCTTTCAGTGGCAACGAGAGCATCGTCGActGGAACGA
GCTCGCATTCCGGGCGCACATGGACAACATCATCCAGCGCTACGGCCACATCACGGTGGTCAACcTCATCGACAAGGCTGGCAAGTCGCGTACGGTGCGC
GACCAAGCACAGCTCGGCACAGCCTACGGCAAgTACGTCAAGAAGTACAACCAACAGAGCCACTCGAGCGATGGCGCGCCGCCTGGAGTGCCACCAAATG
GCTACTCGAGTGGCAACAACTCTCCGACCAAGCAaCGCTCGGCGTCGGTGCCGAATGCGGCGTCGCTGTTGAATGGCATCGCCAGCGTCGCCAGCAGCTT
CCATGGAGCGTCTTCCTCCTCCTCAAGCAAGGCGACTCCTGTGGCCACAACATCGCAGCTTTTCAACGAGCCAaTCGTGTACGTCTGGTTCGACTTTCAT
CACGAGTGCCGCAAAATGCAGTGGCAGAACCTGAGCAAACTCATGGCGGAAGTGAACGAGCAGTTCGCGCAGTACGGATGGTTCGAATGTGATGGTGAAG
GCCGCCTGCTGACGCGTCAGAAGGGTGTGTTCCGTGTCAACTGCATGGACAACCTCGACCGTACCAATGTGGTCATGTCGCTCTT