Description :
From Genome Similarity Track
Location :
Scaffold_17:261331- 267013
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G007099Protein of unknown function
Pytul_DAOMBR144PYU1_G007098Similar to PKAR: cAMP-dependent protein kinase regulatory subunit (Blastocladiella emersonii)
Pytul_DAOMBR144PYU1_G007097Similar to Brd4: Bromodomain-containing protein 4 (Mus musculus)
Pytul_DAOMBR144PYU1_G007096Protein of unknown function

Sequence
5682 bases(100 bases per row)
ACACGCACTGCGTGTTCGTCGTGCAAGTGGACACGGGCGCCGAGCAGTTTGTGATCCAGAAGAGATTCTCGCAGTTCCGCGCGCTGCGGCAGCAGCTCTT
CGCGCTGCTTGAAGCGAACAGCCACTGCGGCAACGGCGCGTGCAGGCAGCTCGCGCAGCTCACGCAGCTCAAGTTCCCGCGACGCACGCTCCAAGTGTTT
GGCAAGAAGAGCGCCGACCTCGCGGTCGCGCGCGAGCGGCTCATCGTGCTCCAGCGCTTCGTGGACGCTATGCTGCGCGTGTACCGCATGGCGCCCAAGC
GCCAACTACGCTGCTGCGCCAACACCAATTGCATCGCCCTGGACACGATCCGCGCGTTCCTGGAGATCGTTAACCCGGAGAACCCACTCGCCATGTCGAA
CGGCTCGACGGCATCCACGGCCACCAACGACTCGGACTTCAAAATGTCGGAGGAGCGCAGCTTCAGCAGCAGTTCGACATCGGAATTGAACTCGAGCGGC
GTCAACAACAAGCGCCGCGGCTTCCCGCCGCCCACGCGTGTCACGCTGCAGTCGCCGCACGAGGCCGCGCACCAGTTCGAGCAGCTCTACCCCATCACCG
AGGACACTGAGCTCGTGCACATGCACGCATAGAGACCAGGTAGTTCCGTCCAGACAAGGGGATCTGAGAGCATATATCCCTTTATAACCACGCACAATGG
TGGTCAGTAGTAGTAGTGTAGACTGTAATTTATCATAAACCAGAACACCCTCTTTTTTAACTTTATACTTAGCATATAGCGAGCCGCTATTATGTGTCGT
CGCTGCGCGTGAACAAGGACACGATGACGGATGTAACTTTGTCGTCGTCGCCGCCGAGGCCGCCGAGGATCTTGGCCGTCTTGCCCCAGTGGATATTGCT
CGTGATCGCCTTTGTACACAGGCAATATGCACATGTGTAAAGAGTAGATAGAGCCTATATATGATAAAGCAAGAGTCGATAGACAAACGTGCATACCTGG
TCGTCTGGCGGATCAAGACGCTCGCCATTCCGGTCCGTGACGATCTCATGCGCGCGCGTCTTGGCCCACTGCAACACCGTATAAACACAATATAGCATGA
TACGCGCACATATAACCACCATAAAGAACACACACGCACGCACCTCGAGCCATTTCTTGTCGCGCGCTGGGCCGCGCTGCAGACTCGAGGGGTTCAGCAC
GAGGATACTCGGTCTTCGCTGCACATTCTGGTGCGTCCTTGGACTGCGGGCGTCTGGTCTCGTTGGAGACCGCACACTCGTGCATGTGCTGCTGCTCACG
ATGGAAACAGCTGCTGGGGCGACGGGCGGGAGCCTCGGGCTCTGAGTGTGGCGCTTGGAACGGATGGCGCTCACGAGCTCGCGCTTGTACTGCTCCCAGG
TCGCGTCGACGCGCAATTCCTGCGCGACGCTGGAGGCGTCCATGCGTCCGCTGAGCACCAGCGCCTCATGCTTCAAGAGTGACTCGGTGGTGGCGTCCTT
GAGCGCGACGTGGCGGAACTCGAGCCGCTCGACGCGGTACAGGATCGCTGTGGGTGAGGATACGAGCACCGAGAACACGGCGTTGGCCTTGCCGAGCACG
ATCTCGTACGCGCCAACGTAGTGGCGGCTCCCGACCGTACAGATCTCGACAAAGGTGCCAGACGACGCCTCGTTGGCGAAAGTAGGCCATTTAGTGTCCT
GCGGTGGTGGACGCTGTGATAAGTTGAAGTGCTTGACGAAGCGACACTCGCCATGGCGCACAAAGTAAAAGTAGTCTGTAAGCGTAGACAAAGAGGGCAT
TAGAGCAGCTTTCAGACTTGCTCTGTTAGGTACGTCCACGTACTCGCGAGCTCGCCTTCGCGCACGACGATGTCGTTGTACGAGAACGCGACTTTCTCCA
TGCGCGTGCACAACTTGAGCGTCTGGTTGGTCCCCCAGTGATCGAAGCCCCGGACGCTCGACAGGAACGTGGCCTTCTCCCTGTTCGTCAAGCGAGAGGT
CGTGAGCCAAGCAAGTGCTTCAAATGAATGCGCGGATCCCCATTACCTGAGTTCTCGGCCGATGTTGGTGCTTCGCAGGTCCAAGAACGTATCCTTGTCG
ATCTTCATGAGCAACGTGCGCTCGTTCGCGACGACGGACGCCGTGCGGTGCGGGTCGCTCAGCAGCAGCCCGACGTCGCCAAAGCACTCGAGTGGCTTCA
GCGTTCGCACGACATAGTTGGCGTCCTGCGAGAGGTCTACATTGTAGTCACAGTTCCGTTAGTATCCCACCGCAGTTGACTTTGTTAGATTCTGTGTGCA
TATAGCATACCTTGCGCGCCGCCTGGGTTGAGCAGACTCGAATGCACGCGTGCGCGCGAGAGGATCTCCTCGAACTCGTTCAGCGTCGGCACCGCCATGT
GCGCAAAGTCCATCACGACGTTCAGCGAGCCGTACATGACGCAGTAGAACGCGTCGGCCGCGTCACCGATATGGAACAAAGCCTCGCCCTTGTCGATCTC
CATGCCCTTGACGGCTTTCAGGTACCGCAGTCGCTCGCGCGGCGGGATATCGGAAAAGTAATTCACATAGTGGACTGCAATCACCATTCACCAGTGAGTC
CCAAGCATCACCAAGCACGTGGCATCTCTATAGAGTACTAGAGTTTACCATATTTGTCGAGAAACTCGTAGTCTTCTCTGCAGCGCAAGGCGTCGGAGGT
CAGTAGGATGCGTCGCAGTGCCGCGCGCACCTCGGCCGTCGGGGAATCGCCATCAAACCCGATGCTTTGACTGATACACACACACACGCACACACCTTCG
TCCAGTGAGCTTGGCATGTAAATGCTCACAGTCCTGCCATTGTCCACGTACGGCCGCATTGAATGCATCACTGGTGCCACTGCATTGGTGCCCCGTTTTG
AAGCCATTGTGAGAAAGTGCACATGCTCTATAAATAACCCAAAGTGTACCCATGTTGTCAGCAAGTTTGACCCAGTCACTCCAGTCACCCGAATTAACCC
AAGCAAAAACCCATTTGCACTTTTAATTGGTGTTCAGTGCCACACTAACCAAGGACGATGCTGCGGTTTGGCGCCTTGCACGAGGCTATTTTGCCACAAG
CAACAAGGGAAAGCAGGTATGCTCACGGATGCCTCCGCTCTCGCTCTGTCTGTGTTTCTCTGTGCGTGTGCTATTCATGAGAGTGCGCGTATACATAGCT
GCACTATATAACAAGAGACGCCTGTGCACGTGGGGCACGTGGACCGAGCGCTTGCTGCGTGCCTTGGGCGGTCTACTTTGCACGCGCTCATGCGTGTGTG
AGGAATGCGCTGTGATGTATGAAGGAGACGAATATCTCACTTACAAACGTTTTTTTCCCTTACAGAACGCGCGTTTAAACACAAAGAGCCGCAGGTATGG
ACCCCGAGCAGAAGAAGAAGTGCAGTGAACTGCTCGAGTACTTTTTTAAGCTCGACAGCACAGGTGCGGCAGTTGGACCAGCGGCCATGAGCTCTCTATA
ATGGCGAGAGTGCTGACAGAACGCGACTGTGTTCATGCGCTTGTATTGATGCGAACTGACCCACGGTAGAGCCTTTTCGGGAGCGCGTGAACTGGGAGGA
GTGGGGACTCTATGACTACCTGCAGGTGGTGAAGATCCCGATGGATCTTGGCACGATCCGCAACAAACTGAGTAAGAACGAATACAAGAAGCCCGTCGAG
TTTGCGCGCGACGTGCGGCTCGTCTGGGACAACTGCAAGCTCTACAATCAAGTACGGCGGCAACATTGCACTTTTGTGTATACCTCCTGCACATGGGGAT
TGCTGATGTTCACACCTTGCATTATGTGTGTGTGTGTGTGTGTGTATGTAGGATGGCTCTGAGTTGTACGACATTGCCGATGGACTTTCCAAGAAGTTTG
AGGACCGCGTGAAAGCCATGAAGCTCGATGTCGGCACTGCCCCACGTGCTGACAAAAGCGTCCCGTACGTTCCCCTTGTCGTCGCCCATTTTGCAACACT
CTTTCTTTTTTAGCCCATAATGCTGACAATTCACTTTGCTGTTTGCTTGAACCAACTAGAGCGCCGTCAATCAATGAGAAGCTCCATTTTAGCCAGAACA
TCTACAAGGTGTCCACGAAGGATCTGGGCGCGATCGTCGCGATCCTCGAGGAGAAATGCCCCAAGGCTTTGGACAAAGTGCGTGTTTTTTTTGTCGTGTT
GATGGCTGGTGATTTGTGCATATCACAACGCTAAATAACGCACGACTCTTGCTCTTTTTCTTCCTTAGAGTTCGACGGACGAGTTGGATATCGTGATCGA
CTCGATCGATAACAAGACGTTCCGCGAACTCGAGACCTTTGTGATGGAGCGCGTTCCAGAGGGCAGCCGCGAACCCGTGACGACGCCAAAGTCGTCCAAG
AAATCGTCGTCGTCGTCGAAGCGTTCGTCGAAGGAACCTTTGTCCAGTTCGGCGTCCAAGAAGAGCAAGACCAGTGAATAAGCAAGCGCCACAGATTTTT
CTGTTCATCGTATTCACTTTTATCTCGATATTATATGGAAAGCAGGAGAGAAAAAAAGACAGGGCATGCTGTATTGGTTTATGGTACATGGGTGAAGAAC
AAGATGGCTATGCTTGAATGAGTACGGACTGGTTGGTTTTTACTTTTTGTTGAGCAGCGTCTTTGCGAGTCTCGCCTGGCGTTGGAATGTCATCTCGAAG
CTCTTCCTCGGCTTGATGTCGTCGTTATTGTCGCCTGCAAGCCCGACGTTTGCCTTGTTCACAGGAATAGTGCTGTTCCCCGCGTTTATCGAAAGCTTGG
AGAAGTCCAATGCTGGGACCGGCGCCGTCGTCGGTGTCTGTAGGTCAGAGGACGGAGAGTTTGCGTCTCGTGGTGCAGCCTCGTGTACATGTTGCTGACC
TGGAGAAGAAAATGTATCTCGCTTAGGTTTCGCTGTGGAGCCGGCGACGCGACGAGTGGACTGCCATTGCGGAGGCACGATCTTTGCCGCTGGAAGGCTC
GAGGAAGGATACTGCTTGAGTTCATTGCTGTTGAGAATTGGAATGCTCTGTCACAAACAAACAAAAGTCAGCCAATACGAAGAGAGGAAGAAGACGAGAA
GCACGATAATCGTGCATACCTGAGACGGCGGGAGCTGCATGATGCGAGATCCACGAGCTGACCGCCCGTGAGCCGAAGAAGACGAATCTCTGTTCGTCGC
GATGGAATCTTTGTATTCCAGAAGCTCCTCCTTATGCAGCTCCATCAATTCTCTGCAGCAAAGTAGATCGTGGAAGAAACGTCAGCACAGGGAGGGTAAC
ACAGCAAATTCTTTCGCTTGTGGCTTCGTACCTGAGCGAAAGTTCATCGCCATTGGAGGCATTCCATTTCTTGCCGTGGATTCTCTTGCCTGCTTTCATG
AGCTTCCGCCATTCCTGCAACGTGGTACGTGATACCACCAACATCCAACATGTGCACATTTTTCTGAAAATGAGTCTCACTCCATGTGCGCAGCTTTAGA
TCTGAAGCACCATACACGCAAACCTTGTCCTGCTCGTGAGATTTCTCGACACGCGACGTGACAATCTCTTCGAGTTCATCATGATATCGCAACTGCTCCT
CGCGCTCCGCTAGCTGCACTCGCAATTTGCCGATGAAGCGATTCAAGTCGTCCTTGCGGCGAGCGATTTGGGTCAAGACCCC