Description :
From Genome Similarity Track
Location :
Scaffold_49:26132- 30137
Transcript NameFunction/comments
g6937.t1RAW31845.1 hypothetical protein PC110_g11805 [Phytophthora cactorum

Sequence
4005 bases(100 bases per row)
TCCGGTGCACCGTCAGAGCCGACATGCAGCTCTATATCTACCGACGGGTCTTGCAGAACGTTCAGCATTCGTTTACCGCTTGGGTGAGCTGCCAAAGCCT
GGTGGAGTTTCCCTGAAGAGAGCAACTCGCTTTGCCGGCCTCGAAACAGCTCGTTGTCGCCATAGAAGACGATGCCAGACGAGAACACCCCTGTCTTCGC
TCACATTGACAACACCACAGCAAGCATGAACGCGTATTAGCGCGGGGACAAGAACGTAAAGAGACAGTGCAGAGGTACACCAAGGTCGACTCACAGGTAA
CACGCGCAGAGCTACATAGAGCTCGGTCAAATCGTTACCCGACAGGTGAGTAAATCTCACAATGACTGTAGCGCTAGCGGAATTGTTGTCCTGGGTGGCT
TGGATCAAGACAGGAGCGCTTTCGTGCAGTGCTTTGGCGACACGATTTATTAACTGCTGGACCCTTGCACTTTTGTGGAGATGATGCAGTCTCCGAGATA
CTGGGTCTTGTCCGAAGAAGTCGGCGTCTGACGCTGGCTGTGTCGAAAATACTACATCTCCGGTCTCAGCGTTCATGAGAAAACCCCGCGCCACTCGAAT
AGCCGAAGAGTTCTGCATCAAGAAAACTGCGCTGTCGTGACTCCACGACATGATCGAGTTCAGGAGGCCTCGGGCGGTAGTTTCCATCACAGGGGTAACA
AAATCGCTTTGGAAGGCGACGAATTCGTCCAGGGTGCCTTCGCAGTCGTCTTGAAACCCGCCCAGAGCGCTAGTGAGCGTATACTCTTCCGCCATCAGTC
TGGCGTGCGCGACACTCTCCACTGCTAACCGCTCGATGTCACCTCGATAGCACCGCACGAACTCCTGCAGGATAAGCAAACTCTTGAATCGGCCCAATTG
CAGCGGCGCAACTTCTGCTGAGAATTCACCGTGGTTACGCCCTGATGCTGGCGGTGTAGCACAAATGACACCGACCGAGATTTGCGCTTCCACATGTGAA
GAGACCAACACCGTGAAGCCATTTTGCAGCTCTAGGTGGCCAAACGATTGTGCCTGTGCGTAGTGGAAAAGGCTGGCGAGCAGCATCGCAAGCTGCGGGT
ACCGGAAGGGCAGCGTGTCATCTTGATCCCACAGCAAGAGTATGCGTCCCGATGTCGTCACGACCAAGCACGCAACAGGCGAGGAGCGGGTCTCGGGCAT
TCTTGAGGCATGCACAGACTTCTCGGTAGATCAAAACGGGTAAATGGTACACGCAGAGACCTTACGTACCGCCCTCGAGCAAAGCAACAGCAAAATAACT
GCAACGCGCATGAGCGCTATTTCTGTGTAAAAAGTCGTTGGCAAACAGCACGCAGTTCCATTTCGCGTAATGGACAGCTATGCGCTAGCACACTGTTGAT
GCTGCGCTTGGCTCTTCAGGATTGTCTGCACATATCGCTACTCTGCGGGACGTCAGTACGAGCGGTCGGGCTTGCAGAGCTAGAGGAGGTGTCATCTGCG
GAACCGAATCGGACAGGAATTGTCGGGTATGTCGGCGTCGTGGCTTTAGCAGAGCGCTTCGCTGGCTGATGTTCACCCGCAGCAGGAGCGGGAGCTTGCA
TCAATGGGAGCGATATCATGGGCATCGACTTGAAAAAATCGCGACTAGCAGCAGCGGAGGCTCTAGCCTCCTCCTCTTCAGCTACGAATATCGCCAACTT
CTCGTGAATATCTGCCAGCTCTTTATCCAGAGCAGTGTCTTCCGCCTGAATGGCTTTCTTCTCCTTTTCGTGCGCGAGCTTGAGCGAGCTCAGGTCCTTC
TTTGCCTGAGACTTTAACTGCCGCTCGAACTTGGCCTGCTCGGTCCGCATACCATCCAGCTTCTTGGCTTGCTCATTTTTCAGTGCAAACACCTTCTGCG
TGTGCTTTGTCTTCTTTTGCACCACTTCACGTTCCAACTGGACAATCTGTGCCATCAATTCCTTTTGCTGTACAAGCAACGAACGCTCTTCCTTGTGAAA
GCTGCGCTGCTTTTCTAAAACTTGAGCGGCAGCCACCGAGATTAGTTCCTTGCGCTGGCGATCCGCTGCAAAAGTCTTTTCCAGCTCTTCCGTCCGACTG
CGAGCCCAAGCAAGGTCGCTCTCCGCGTTTTTCACCCGCACTTCATGCTTCAAGTTCATTGTTGTGATCTCTGTAGTCAGGCGTTCCAGCTCACTCTTTT
TGCTGTTGAGTTCGCTGTGGAACACACGACGCAGTTCAGAGAGCTGCTCCGTAGCCTGCGCCAATTGCTGCTCATAAGACCGCTTTTGTTCATTTGCGGA
AGTGGCTGTGTCAGTGCCTTGTACCTTGGCCAGACCATGCAATTTGTCAAGTTGCTCTTTCTCCTCCTGCCAACTCCGCATGTGCTTCTGGTACTGGTGG
ATCACCGTCGCGCCCCACTTTTGAATGGAAGCGCGTACAGACTGCAACAGCGCCTCCTCTAGGAGGGTATCTGCAGCTGGTCCGCTGCCTTGCTGAGCGT
ACTCATCTAGTGCGCTCCGCAAGTCTGACTTGTACTGCGTCAACAGTCGAATCAGACCATCGGAAAAGTCTTCTCGTGGTCGTTCAGCGAGCTCAGTGGC
CACAGCCGCGAGGTTCTGCGGAAGAACTCGCTCGAGGATTTTGGAGCAAATTTCTGCTGACAGCGTGGTGTTACGCTCCAAAGTTTCTTGGAAGTCACGA
TTTACCTGCACTTCCCAACCCTCCAAGTTGTCCTTGAACAGCGTTTTCTGCAGTCTCTCCGGGAGGTGTGAGCGCACCTCACGGATATGGGCCATGGCCG
CCTGAATTCCACGAAAATGAGCCAACTGTAGACACCGCGCGTTAGGGACTTTCTCACCGGTGCCACTCATGTCATCTTCTTGACCGGGACTCTTCGCCAC
CTGCATTTCTGCTGTGTACGTTTGGTTCGCTATTTCAAAGGCTTCTGCAACCTCTTGCTCCAACAGTGCATTCGACGCCTTCTGCATCGTCGGCAGCAGA
CTGGCATTCATCATGTCCACGTACGCCTCAAGGACAGCTACAAACTGCTCGGAGCGCAGCTTATGTCCCATCAATTCCTTCGCCGGAAGCCGCTGAGCCT
TGTCCGACAAATAGTTTGCGTAAATCTCGTCCACAGCCTCGACAAACTGTGTGCGCAGTTCGCTCCGGGCTGTCCCAGGTGGCACAATCTCCGTTCCGTT
GCCTTCCACTGCACGGCTCAGCGCCACACAATCCCTGACCGGAAAGTACGACTCCAAGTACATCCGCATCATGTTTCTTTTGGTAGCAGCATCTCCGTAG
CCTCCCTCCGGCGCGAGACACTGCTCAAAATACTCCATGGACGTCAACTTCTGTCCTTCCGTATCTTTGAGCCACTTGACCTTGAAGTTCCTCGTCAACC
AGATGAACTTGGGGGCATGCGCATGGAACTCACCAGCTGCACCAGCACAACATAAAGATAATCAGCTGTTAGCGTCGCCACAAGGCAGAAAAACAGAACC
ATTCCGAAGGTCTCTCACCGACGGCCTCTTCATCCTGCATGCCCTTGATCCTCAGCACTTGAGCCACCTTCTCCAGCCACTGCAGCCTGCCTATAGCTTC
AGCGTTGATCTCTCCGTCTGTGTTGTACAGTAGCGCGGAAGAGAGCAGCAGTAGCAGCGCCAACTTGTGGTTCTCTGTGTCCTGGTCGTTCTCAGACTGC
AGAGCTGCCCCAGCGGCCAGAACAACGCGAGCCTTGTCATCAGTCTTTAGCGCTTCTTCTTGAGGCACCCACAGCCACAGAAGCACGTCGTTTCTGTCCT
CAGAGGCAGCGGAAAAGTCCACATCTTGAGGCTGCAGCAGAGTATTGAGTAGCAGGCGTTTTCCAGTCGCTGCAGGGCCGAATACGCCCAGGACACCGAT
GTTCTGGGCATGCATCGAAAGCAGAGCATCTCGCGCATCAGGTACGACCTTCAGCGTCGCACCAGCATCGCTGATGGCCGCGCAAACTAGCGGAAGCGCG
CGCCA