Description :
From Genome Similarity Track
Location :
Scaffold_208:26132- 27569
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_208-fgenesh-gene-0.5Phosphatidylinositide phosphatase SAC1

Sequence
1437 bases(100 bases per row)
GAACATTTCATTCTCCCTTACgCGCCTTGCTCTTCTCCCCGTCGCGAGGATGAGGTTCACTATTCCCAACTGTTCTGACACACAGCACTCCGGAATAACG
TCATACCCGTGATGTGCATGCTGAATTAGGAAACGCCTTTTGCTGGCGAACTCAATCCTGTCAGCACCTTTTCCCCGCAAAAGCGTTCTTGACCATTCCC
AAAAACTCGGGTTCGGGTATGTGTACAGAACGGTTGACTCTTCGGAAGTCACGACTCACCTTTGAGACGAGTTGAAGGCTAATGGAGAGGCGTACCTTCA
CAAGAAGGTCGCGGTTCCTTAAGTGTAAACTGCTGCTcctAAAAgACTTGCTTCTACCACTCAATTCCTCTACTCTTCTAGTGAAAGTATATATGGTAAG
CTTCAAGGAAGAGTTCTCGACTACGCGAGTTCAAGGAGCTCTTGACcGTCTTGCCACCACTTGTCATCCATGATCACAAGGACAACCTGGCCgCGCGACG
ATAATGCTGTAATCCAGCCTCCGGATTCCAcGTgcACCATTGCTGTTGAAGTGCTCGATTCGCTCCCCATTCGGATTTGAGATCGAGGATCAGACAGCTC
TGTTCACGAACTGTCGAACTCTCGGCTCCATCCCCCTTGCGTTCACACGAGCTCTATCAACCACAACTCATGCGCACGATCTATCAACAAGGaCGCTGGA
CGTCGTCATCATGACATGACGACCATGCCTCATCCACACCCAGTGTCCAGTCCACAAACAGCTCAGCCTCAACGATCCTACATgcATCACAGTACAGTGT
ATTGAGGCTTTTCACGCAGGCCGTTTAGGCGCGCATGTGCTCGCACCAACATCTCACTGGCGTTCTCAATGTCGCTACGACACAGGTCCAAAGCCCTTGG
AGGCTCCAAGGGCCTTGTCCAACTTGGAACCAAcTCCCATTGCCACTACTGTAGAGCGTAATATGACCTTGTCGCAAGCCAATCACGGTAGAAACTCTGT
TCCTTGGCTGGGGCAGagTCTAATCATTCCGTGTCGCTGGCTGAGCTTGATGAGTCAGGTCTAACGTCAGAGCCATGGGGTTGTCTATGGCGGACCGTCG
TGTGCTGGCCTCGGGGCGTCGTAATCCGTCGTCATGTCCCACCCCGGGTGCAGTGTCCGGTATTCGGTGCATTCCGAGTTTGCATCCCCcTAAAAacACC
ACCAAGCTTTGCTCTCGAATCTATTTTTGTATGGAATCAGTTCCAGTGTGTTGTCAAATTGGGGACGAAGAGAGTCGTTGCATTGTGACTGCCGGGTAGT
CACGCGTCTCACCTCATCCAGCGTGCGATTGCCACGAGGAGCTACGCCAGGAAGCCGAAGCAGGCGGAAGTCACTCGctcTCTCTCTCTCTCCAGTATGT
TCAAGGTGCACGTCGAGAACTCGGAGCTCCTGCTGGA