Description :
From Genome Similarity Track
Location :
Scaffold_86:261288- 265534
Sequence
4246 bases(100 bases per row)
CTACCTATCAATATACCCAGTTTACATTCTACCTTAATTAGGTCATTTGAATAAAGAGGGGGCCTGTGAACTGCCGTTCACTGAGAGTTAGTATACTCTC
GAAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTCGTAGTCAATCCACGCCACCGCGGGTAGACTACCTGAACCTC
TCCGAAGCTGGAAAGGAACGATTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGATGGAGGCCCTGCAGAGC
CTGGTTGTGTCAACACCGGCCGAGCAGCTCGAGCGCGTCAATGCGTTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTGCGGGAGAGCCTGCAGGCTC
CGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTGAAGCCGTATGAAGGGAAGGAAGGCGAGAACCCTCACTTCTGGGTCCGAGA
AGTAGAGCTCGCGATGGACGCGGCTCTTATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGTGCTAAGCGTTGGGGTGTA
CACACGGGAAGCAACGTCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGTGAACAGCTCCGAGGCGCGTTCCTCCCGGCAACCTACGAGTACCGCCAG
CGTTCGCGCTTCCTCTCGTGTAAACAAGGGAGGCGTGAGCAGCACGAGTACGTGCAAGAGATACGGGAGCTCACGGCGTCCCTAGTGGGAAACCCACTCA
ACGAGCACGTCAAGATGACTGTGCTCATGGACAGCCTTCGAGTTGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGTCAAGCACCCTTGAAGAGGCGAT
TCAAGTGGCTCTTCAAAAAGGGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCCGCGTGGCCTGGGAGTTCCTTGTCGGCTCCCGGTCGAACAAGCCCC
AACGGACCAGTTCCTATGGAACTCGGAGCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGCGGGAAAATGGGCCACTTCAAGCGCGACTGTCCCGCGG
AAAGACTTTGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGAGGACAGGGGAACGCAGGGAACCAGTAGGGGCG
GGGCGCCCTACTGGGGAAGAACGAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGACTTAGCCCCTGAGAGTCTTCGCACTCTCGAATCGGC
GAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATCGATCATCCCTTTAGAATCTTGATCGATTCTGGGGCGTCGAAGAATTTCGCAC
GCCGCCAGACGGTTGCTCGCAGCAGCAACAAGTTGTCCGATGCTTTGAGAGAAAGCAAGGGCAACGAGACGGTGTCAGTGCGATTGGCCGACGGGAAGGT
CGTCACTGTCCCCAACTTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCGATATGGATCCATATGATATG
ATCCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCAGTCTGACAGAGCATTGG
TGAGTCATGTTCCCACCTCTGTAAGGCCCCGGGGCGCCCGCAAGGGTTGCCAGGGTACCAAAGCAGCCGGCAGATGCTTGGGAGTCGTCAACGTATATGA
CGACTCCAAGGTTGTTTTGATGGTGGCAGCGCCCAGAAGAGGCGCTGGCCAAGTGGGTAACCTAGGTCCACAAGCGGGTAACTTTGTTCCGCTGACAGCT
GCAGCTGCCACGAACACTGAGAACATCGTGTTCAGAGTGGGTAGAAGAGTTCCCCTCACGGTCGCCCAGACCTTAACTGAAGAGGAAGACGTCGGATACG
CTTCCTGTGTGGGTAACACAGTACCACACGCGGTCGCCCAGACCTTAACTGAAGAGGAAGGCGTCGAACACGCCTCCTGTGTGGGTACCATAGTACCACA
CGAGGCCACGAGTGCCTCGGATGTCGTAGCGCCGACATCCCTAGACGTGGGCAGCAAAGCTCGACGTCACGGTCGCCGTCGTCAACGACGCCGCCGCCGC
CTCAAGTCGGATCCAAACTTCGTTCCGATCGACGTCGCCTCAAGCGACTCGAAGTCCAGGGCCCGAACTCCTCCGACAAGGCCGGTGGAAGAGTGTTATC
ACTTCTTCGATGGCGAGACAGGTTTACCCGTCAAGGCATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGAACCTCGAGGAAATGAC
GGCTGAGTCTTTCCTGGCCAACCTCAAGGCTGGAGAGATTGCTGAGATGGTACTCATGAGACCTGAGACCACTCAGGAGGAGCTGAACGCCTCCTCTGTC
TTGGACGAGAACGTCCTGGAAGACATGAACAAGCAGCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAGAATCCGGTGTATCCTTTGGTGA
CGGAGTATGCGGACGTGGTGAACAAACACCCACCGACCCAACTCCCACCGGATCGAGGCGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTG
TGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGTGCGAGGTCATTGATGCCTTCTTCGCCGCAAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCC
CCGCACTCGACGCCGACTTTCTGCGTTCGTAAGCCGAACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAA
CACCGATCCCACGAAAGGATGTGTTGTTGAACAACATGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCG
AGAGAGTGACATCCCGCTCACCGCGGTAAGCACTCCAAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTC
AATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGTACCTTCGTACAGACGTACTTCGACGACATTTTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGG
CCATGGAGGTACATCTAGGACACCTCCGTCGAGTGTTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGA
GATCAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGGCGTTCGGGCTGACCCAGACAAGGTCAAGGCCATAGCAGCATGGCCGACGCCCCGATCCCAGAAG
GATCTTCGAAAGTGGTCGGGCTTGGCCAACTACCTTCACAAGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCTCTTGTCGAGCCTCCCTCAGAAGGACG
TCGACTGGCGCTAGGAACAAGAGCACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGTGGCCCCTGTCCTGGCTCTGCCGGACGAGACGAAGCC
GTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATCGGGTGTGCATTGCTGCAGGACGACACGGCTGGACAGGAACGAGTCATCTCGTTCCAGACCAGG
CAGCTCAAATCCGCCGAGCGGAACTACCCTGTCCATGACAAGGAGCTTCTGGCAATGAAATATGCCCTTGTGAAGTTCCGTGTTCACCTTCTGGGCTCTA
GGCCCTTTGTGATCTACACGGACCACGCGTCCTTGAGGAAGGCGACTAACTCGCCTCACCTCTCCCAAAGGATGGCGAGGAGGCTGTCCTTCTTCGCGGA
ATACAACTACTGCGTCGAATACAAGCCGGGCAAGCTCAACGTGCTTGCGGACGCCCTCTCTCGGCGTCCCGACTATGAGTTGGCCCACATCGCGCAGGCG
ACAACGGATCTATATGATCGGATACGCATGGCGTATCGGGACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTTACAGCCGGAACGAGCGCGAAGCCCG
ACTGGCTCTCGTCGCGACAGCGCTCAAGGCTCCACCGATATGAGTTGAAGGAAGGCCTCCTCTATTATCGGGTGGAGCCCACTGATCCTCCACGGGTGGT
CGTACCCAACGACGAGGATCTGAAGCTCGACATCCTCGCGGAGGCG