Description :
From Genome Similarity Track
Location :
Scaffold_78:26127- 28950
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_78-fgenesh-gene-0.14Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel

Sequence
2823 bases(100 bases per row)
GACCGACCTGGCCCTCCTTGAAGACGTACTCGCCGGGGGTACAGAACTCGGGGTCGAGAATGCCCATCAAGTAGCTTACACACGCGTCGTCCTGTGTCGC
AAAGAAGCTGATCTTGCTCACGACGTCGCGATTCAGGTGCAGGACAAGCTGGCTGCGCAGGTTATCCGAGAGCGACGAGAGGATCGCATCTTCGTGCTCG
TCGTCCCGCTGCAGCAAGTAGTACTGGTAGTATCGGCGCAGCCGCACGCTGAGCGGCTTGGGGATCGCGCGCTCTTTGAGGTACGCCTTGAGGCGGTCCA
TTCGCTCGCGATACATATCGGACGATCGGTGGAACTCGTCGACGAGACTCGAGACAGTGCCGACGACGTAGGTAAAAGTCGACGCCCCGATGAGCACGCC
GAACGAGACGAACGCGACTTCGACGGGGTTCTCAGGCGGATAATCGCCATACCCGACGGTCGTCATCATTGTGATGGACCAGTACAGGAAGAACACGTAC
TTCTCGTAGTTGTTGTACGACTCGGGCAGCTGCGACAGGATGCTTGCCGGAGATCCATCATTCTTAGGACTCCCCACTCCCTCCGAGGCCTTCGAGACGA
CCAAGAAGGCGCACGTGAGCACATGAGCGATGAAGACAACCCGGAAGATGAGTCGCAGAATCCGCATTGTCGTGTGGTGCGACGCCACGAACACCATGTT
CTCGACCCGTGTCAGTGTCCGAATGAACTTGAGCACCCGAGCAAGTTTGAGTATTCGGATGGCATGCGAAAGCACGTGCAGAAATGAGTCCGTGCGATCG
AAGTGGTGTAGCGCGTACTCGGTCGTCCAGGGTAGCACGGAGAGCAAGTCGAGCCAAAACCAGACCCGCAGGTACTCGCGCCAGATCGTCCGGTCCGAGA
TGACCAAGTGGCCAGTCTTGTCGATCACGGCGGTGCGGAAGCTCAGGAGAATGTCGATTGCGAAGATGACTGTCATGAAGCTCTCAAACTCGTCGTTGAG
CCGCACGCCGCCGCCGAGGAAGGCGAACTCGTATGGGATCGTCAGCGTGCAGTAGAGCACCAGTAATCCGATGAGCATGTCCCATGCGAGCTTGAACGAG
CTGAACGGGTTGATCGGCACGAGCAGTGCCTTGGCCCACTTGTGCCAGATCGATTTGTCGGTTTGCGCCGACAAGATCTCGATCATGCGCGTCTTCTCCG
TCGCGGAGTTGAAGACTGACACTCCCATGGACAGATCAAGCGCGAGAGCCCGCAATATGTCGATGGGTAGCGACCGATACGATCGGAGCACGCCGTCGAG
CAGCACCGTGAGCGTTGGGTAAATATTCTCGATGCCGGTCATGGTGGACACAGGGTCGTCGGTGCGTGACTTGACAAAGACTCGATAGCGCGCGATGGTT
TGGTCGAACACGTGGTCGTAGAGCGTACTGCGTTCTTGATGGTACGCGATGAGCGTCTGCTCTGCGTCGGGGAACTCTTCGATGAGTCTGTCGAAGTCTT
CCTTCGGCAGTGTGTACAGGTCGCAGTACGCTCTAGCAGTGTACGTGTTCTGGTGGAGAGTGTAGTTGAGCAGCGAGGACTCGCCAAAGATGCCGTTCTC
GGTCAAGATCTCGAGCACGACGATCCACTCGACGACTGGCGGCGTGCGCCTGACCTCGACGATGCCCGAGTTGAGGATGAACATTTCTGTGCCGACAGCG
TTTTCCTTGGCGAGCACATCGCCTTTGACGGCGATCAGCGGCTTGATGAACATGGCCATGTCCATCACGAACTGCGGACTCAGACGCATGAAGGCCGGGA
TGAGGAAGAACGAGTTCTTGTACGTCTCGTGCAGGATCTCGCCCCGCAGCGAGAGCGAGAACTCGCACAGCAGCTCGCGCTCGTCAAACGCGCTCGTCTT
GGCAATGTAGTGGCGAAAGTACCGCAGCAACTGCGCCTTGAGGTTCTTGGGGATCGCCTTCTTCTGCACGAACGCTTGCACCATGCTCAGCTTCTCTGCG
CGCGTCGATTTCTCGCGGTTCCAGTTCCCGAGGATCTTGGTGATGTTGCCGATCAGGTACCCGAACCCGCAGGCGCCGACGATCTCGGTGACGATGCTGA
AGATGCGCTCGTTCGTGTTGGTCGCGTGCATGTCGCCGAAGCCAACTCCCGCCAAAGTGGCAATGACCCAGTAGAAGGAGTACAAGTACCGAATGCCGGA
GCTCGCGTCCTCGAGTCCTGCTTGCACGATCCACGTCTCAGATTCGTCGCCGGTGTCGTCGTCACCGGAGTACCCGACCAAATGCCACAAGCATGTCAAA
ATGTGAGTGACGAGGAAGACTTGGCCGATCAAGCGCGTCATGCGGGTCATTACGGCGTCCAAGTCGAGCGTCTCTTCGACTTTCATAGCGAACTGCCGCA
GTTTGATGAGCCGCGCGAGCTTGGTGACGCGGGAGAGACGGATAATCCGCGTGAGCTTGAGCGAGCTCACGGACCGACTGTTGGATGGCCCGGCGAACGA
CTCGATCGGCAAGATCCCGACCACGTCCGGAACGAGCCACGACGCGACATACCGCTTGGCAATCCGAGTTCGGTTGGTCACCATGGGCTCTTCCTCGGAC
TCGTAGAACCCCACGAAGAAGCTCTGAGCCACATCGAGCCAGAAGAGCACGTCCGAGATGGTGTTGAGGGCGACCCACATGTGGCCGAACTGGAGCTCAG
GGAAGCCGACCTGGATGGGCACGAGGATGGCGCTGTAGAGCACGAATAGCATGATTAGCGAGTCCCACGTGAGCTTGCCGTTGCTGCGCGGGTCCAGCAC
GGGTGTTGGGAGCTTCGCGACCA