Description :
From Genome Similarity Track
Location :
Scaffold_470:2612- 5230
Transcript NameFunction/comments
Phyra_86117tranposase

Sequence
2618 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATATGTGCTAACGTAACATGTTC
ACTTCAGATCACGCGAAAAATGATTCGTGACCGACTGGAAGTTTTGAGAAACTTCCTGATTCGTAAGGGAGAGGTTCTCGATGCCAAGTGTGAACGCCAC
ATCCAGATGCGGTCGGATGACAACGAGGCCTTGCTATTAGCTCAGATAGGAGGTCAAATCTATGAGAGAAGATTCAACTACGTTGTGGACTTGATGGGCG
GCAATAGATGATGTAGATATCATTGCGGATAAGTTTCGATTCGGTGGAATCTTTATGCCGTCCACGTGCATTTTGTGTAAGTATTATCGATCGCCGTCGT
GGAAGCTAGAGCAGCCTGTCGATTTGGAGTACGAGACCCTGCCGCCACAAGAAAGCTATCACCTAGTAAGTCGCTGGAATATCACGTGAAACTACCTGAG
GTCTGTCAATTCATCGTACGGGGCGCTGCCATCACAACACAAATCCTACTTCCACGGAGCGCCCTCCGTATAAAATTTGGGTTGCAAAGCGAGATATGAC
TGAAGAATTTATCTTGACCTAATTAAAGCCTGTCACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACACAC
ACACACACACACTTCCGCCAAAAGGTGCGACATGTATTATTATGGTAATAGAGTTAGCAGTATCCTTCCATTCATTAGGTACCACTCCGTTCAGGAAAGA
TAGCACAATTCCACTGTAACTGCTGTTCCAGAGGATAGCACAAACTAGCACTTGATTTAAGTATTACGAAGCACCTACAAAACAGTTTCCTGAGTGAGTA
TCTGCTCTGCACGAGGGCAGCAACGAATTGATACGGGAAGTCTTCCCTCCCGCTGTAGCTTCGCTTTCTTCATGTGACGAGGCTTATAGTTGTTGTCGCC
CCCTTGGGCGATGCAATCATCCATTGAGCCCTACAGACTCAAAAAGACTGCGTTGATGGTGCTCATCGATAATTCCCAATAAGCCTCGATGACCGCGGCA
ATAAGCTCGCCAATCGTACGCGCACATTTCTTGCGTTGGCGAGCTTGAATAGCTGAAAACAGTCTGGGATCGTTGCAGTTGAGATTCGGGCTGTATAGGG
GTTGGTTGCGTAAGACTACATTGCATCTCGATGCAGCAGCAGCTTCAGCAAACGCTGCATCGTCGGCAGCGATGTGTGCTGAAGCGTTGTCTTGCTGGAT
GACAATGGGTTCGCCGTCGGTGACAGAAGGCAAACGATAAAGCAGAGCGGGAAGTAGGTTGGCAATAAGCATGGAGCGGTAGCTCGTCTTGGTCATCGAG
ATCTCCTTGGTGATGATCGTCCCTGCCGGGCGCCGCGCCGAAGATCGCTGAGCTGGCACCTGCTCGACGAAAGGCCAAATGCCCAATTTTCCATCGAAAA
CCTGGTGCGTGGAGGGGTCGTACCTCGGGCGGCCCACGGCGGACAAAAACATCACCCGAGTGATGAAGCGCTTGCTGCGCAGACGACGCGCGGGTGCTTC
TTCGCCCGGCAACAGCAG