Description :
From Genome Similarity Track
Location :
Scaffold_44:26112- 27545
Sequence
1433 bases(100 bases per row)
AGAACGGGTCTGTGCAGGGCACAGACACCGCGAAGACGAACGCAGATGCCGGGCCTACTGCTAGAAACGAGCTGAACGAGTTCAGCTCGGACGCAATCAA
CTTCGTGCAGCGCAGACAAGCCGTCATTCGGTTTGTCCAAGACACTATTGCAGCTTCTGTCGACCGACAGAAGCTGAACGCAGACAATGTTGGTAGGGGC
AACACTAATGAATTCAAGAAGGGTTCATTAATCTTGTTAGCTAGTCTAAACTTGCCTAAACATGCCGTTTCCGACTTCGGGGCGAGCAAGCTCGCTCCGC
GCTTCATCGGGCCGTCCACTGTGGTGGCACGACATGGCAACGCCTACACACTGGACATACCGTCTAGTATGCGCCTCCATCCGACGTTCTACGTCGGACG
GCTCAAGCCATACCTGCAGTACGAGCTACCTAGCTCGGCTGAACCGAAGCAGAAGACTCGGCGGAAGCCGTCATCCTCTCCAGCGCGAAGTCGCGCTGGG
GCAGCGGGTCGAGCTAATGGTCCAGCTCGGCCGGAACGATCGAGGCGGTCTGGGAGGCCGCCGCAACCTGAGGATACTTCAGAGCGCCGAACCCAGCGCT
CTGGAATTTCTCCACGACCGGAACTCGGTCGTGGGGAGACGCGAGATCAGGGTCAACACCAAGTTGACCACACACGGGTCGTGTTTCCACCACCACCGCC
GCCGATTCGTGATGTACACGGCTCAACGCGATGGATTGTTGAGCGGATTGTTGATCACAGTATCCCGAGAACGAACAGGCAACCAGTTCGTTTTCGTACT
CGTTGGAGAGGATTTCTCCCAACCAAGATACATGGAAGCCACGGAACGTCTTGCTCCAAGACGTTCCAGACTTGGTGAGGGCATACGAAGCCCACCATGC
GCTACATACTGGAACGCAATGCGAGCGCTGCTGTTAACAGCAGCGCCCGAAGACACTTCGAGGGCAGACGTAGGTACCTGCCCCCGCGGCAGCGACGCGC
TTCGCACGTTGCCGCGCATGCTACTCAGCACCAGAGAGGTTCTCCGCTGCTGCGCCAGGGGTCTTCAACTTCGACGTGCTCGTTCCATTACGAGCACGCT
CTCTTCAAACGTCACGCATTGACCAAGCGGTCAATGGTGGTTGACGTGCCAGGACCGGCACGTCTAACCTTGACGGGGGGATGGTGTAACGGGGTTACAC
GCACAAGTGGCTACAGTCACTTGTGACTTTAACAGACACGACGTCTGTTAGGGGTTCGAAAGACTTTCTCGTCCTTGGTGTAGACACACCAAAGGCTACA
TACATTTACGATCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAAAGCAGCATCTTTTAGCCAATGAGCGACATGCATAGCATTGG
AATTCTGCCAACCAGCCGTTGGCAGATTCCCAG