Description :
From Genome Similarity Track
Location :
Scaffold_454:26108- 27761
Sequence
1653 bases(100 bases per row)
GCCCAGACCTTAACTGAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTACAACAGTACCACACGAGACCACGAGTGCCTCGGATGTCGTAGCGACGA
CATCCCTAGACGTGGGCAGCAAAGCTCCCCGTCACAGACGCCGTCGGCAAAGACGCCGCCGCCACCTCAAGTCGGATCCGAACTTCGTTCCGATCGACGT
CGCTTCAAGCGACTCGGAGTCCAGGGCCCGGGCTCCTCCGACAAGGCAGGTGGAAGAGTGTTATCACATCTTCGATGGCGAGACTGGTTTACCCGTCAAG
ACATCTGGTGTCCACTTGGAACCGTTGCCAGAGGTTGCAGAGATACTGCACCTCGAGGAAATGACGGCTGAGTCTTTCCTGACCAACCTCAAGGCTGGCG
AAATTGCTGAGATGGTACTCATGAGACCTGAGACCACTCAGGAGGAGCTGAACTCCTCCTCTGTCTTGGACGAGAACGTCCTGGAAGACATGAACAAGCA
GCGTCAGGCGCGCTTGGGTTCTGAGATTCTCAAGAACCCCAAGGATCCTGTGTATCCTTGTGTGACGGAGTATGCGGACGTGGTGAACATACACCCACCG
ACCCAACTCCCACCGGATCGAGGTGTACGGCACGAGATTGATCTCGTGCCCGGCACAAAGTATTGTGTCACGAGGCAATGGCCTCTCCCGCGCGAACAGT
GCGAGGTCATTGATGCCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGGAGTCGAAATCCCCGCACTCGACGCCGCTTTCTGCGTTCGTAAGCCG
AACGGAAAGTGGCGTCTGGTTCACGCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCAATCCCACGAAAGGATGTGTTGTTGAACAACA
TGGCCGGGAGCGTACTGTACAGTGCGCTGGATTTGGTAGACGGATACTACCAAATCCTGATGCGAGAAAGCGACATCCCGCTCACCGTGGAAAGCACTCC
AAGCGGCATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCAATTGTTCCGCCCTTTGCGT
ACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCCATGGAGGTGCATCTAGGTCACCTCCGTCGAGTGT
TGGACGTAATGCGAGAAAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATTAAAGTTCTCGGTTGCTTCGTAAGCAACGTGGG
CGTTCGAGCTGACCCAGACAAGGTCAAGGCCATAGCACCATGGCCGACGCCCCGATCCCAGAAGGATCTTCGAACGTGGTTGGGCTTGGCAACTACCTTC
ACAAGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGTCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAAGAGCACCAGGATGCTTT
TGACAGCATCAAGTCCAGTCTCCAAGAGGCCCCTGTTCTGGCCCTGCCGGACGAGACGAAGTCGTTTAGCGTCGTCTGCGATGCCTCCGATTACGCCATC
GGATGTGCATTGCTGCAGGCCGACACGGCTGGACACGACGAGTCATCTCGTTC