Description :
From Genome Similarity Track
Location :
Scaffold_81:261047- 262728
Transcript NameFunction/comments
Physo_109263aldehyde dehydrogenase

Sequence
1681 bases(100 bases per row)
GATCTCCTCACGAGCGATGGTCATGTCATCCGTGACGTCGGCGAACACGGTGGGCTCAATGAACCAGCCCTTGTTGCCTTGCGCTTGCCACCAGCAAGGA
GTCTGAGCACCTTCCTTCTTGCCCTCCTCAATGTAACCAAGGATCTTCTCGAACTGAGTCTCATCGATCTGCGAGCCCTGGTCCGTCTTGGGGTCGAACG
GGTCGCCGACCACGCGAGCATTCGCGGCCTCCACCGTGCGCTTGACGAACTCGTCGTAGATGCCCTCCTGGACGAACACGCGCGTGCCCGAAATGCAGCA
CTGGCCCTGGTTCATGAACAGACCCAGCTGCGATTGCTTGATGGCGAGGTCGATGTCCGCGTCGTCGAGAATAATGTTGGCCGACTTGCCACCGAGCTCA
AGCGTGACGCGCTTGAGGTTGCTCACGTGCGACGTACGCATGATCTGGTACCCGACTTCCGTCGATCCGGTAAATGCGACCTTGTCAACCTTGGGGTGCT
GGGCCAGGTGGCGACCAGCGCTGGCGCCCACTCCCGGCACAATGTTCACCACACCCTTGGGGAAGCCAGCCTCCACGATCAGCTCACCCACACGCAGAGC
CGAGAGGGCCGTTTGTTCAGCAGGCTTCAACACGACCGTGTTACCGGCAGCGAGAGCGGGGCCCAACTTCCACGCCATCATGAGCAGCGGGAAGTTCCAC
GGGATGATCTGAGCGCACACGCCGACGGGCTCAGCCTTGGTGTAGCAGAGGTAGGGGCCCGAGATGGGGATGACGGATCCGTGGATCTTGTCGGGCCAAC
CGGCGTAGTAGCGGAGGGTCTTGAGCACAAGCTGCAGGTCGTTCTCCTTCGCAACGTGGAACGGCTTGCCGTTGTCGAGCGCTTCAAGCGCGGCGATTTC
GTCGATGTTCTCTTCAATGAGATCCGCCAGCTTGTAGAGGAGCTTGCCGCGGTCTTCGGCCGACATCGTGCGCCACGGACCCTCGAACGCATCGCGGGCA
GCAGCAACGGCGGCGTCGATGTCTGCGTTGACGGCCTCCGATACGTCGGCGATCTTCTCCTCCGTGGCCGGATTGAACGTCTCGAAGGTGCGACCGCTGG
ACGAAGGCACGAACTGTCCGTTGATCAGCAGATTGGTCTGCTTGACCGGCACCTTGGATGAATACTGGCGGGTCAGTGCGACAGGCGAGACCTTGACAGT
CGTCGCGACAGTGGCTCGGGCGAAGGCGTTGGCCTGAACGCGCGGCAGGTTACGCAGGATGTGGCGCTGCATGGTATTTGTGTTTCGGGGTCACTTGGTG
TGGAAGTGTCGACGAAAGCGCAAAAAGCGGAGTGAGCGTAGTGGACCGCCCGCTCGCTGAGCGTTTGTCTCCTCAATTCACCAGACTGCAATCTCGACTT
GCAGTCTTGGTGGATTGCGGACGTCCCCGGCGAGGCTCTCAGCCGATCTGCTTGGGCTGAGGCAAAGCACCGGCATCCGACGGTAAGGTAAAGCTTGACA
CGTGCTGTGCGCAATCCCGTGATACAAGTGCAAGGTGCAAGATTCCATGTCCATAAGCAGGCAGGGCAGGCATGTAGCTGCCAAAGAAGGCGGCATATTT
CTCGCAGGTGTCCGTCCAGGCGGTGAAGCGACCGAAACACAACCCCATACATGTACAGGCGGCACGATTTGCATGTTGAAG