Description :
From Genome Similarity Track
Location :
Scaffold_3748:261- 2175
Sequence
1914 bases(100 bases per row)
ACCCCGTCACAGGAGGCGGCAAGTACGACGCAAAGGGAAACGCAAAGGCAAGGGACACTCCCGCAAGGGAAACCTACGGCCAGATCCACGATCTAGGCCC
TGGATCCCATAAGCTCGAATATTCGCTTAGGATTCGGAACAATCCACGGACGCAGAGTGAAGATTTTCCACTGCTGCTCCACCCCATCCCCACGTCTCGC
CAACACACTCAAGCTTCACCACTTGAACTCTTCGGAAGTTACCGAGAGAGCAAGATCCCGCCCTACCGACGGGTACACAAGGTGAGGAAAGTTCAGCAGA
ACACGGATCATCGGGGGACCCCCTCCGTTAGTCGGTGTCTGGGCGCAGTTGATAAGTTGGATCCAGCAATCTCGCAGATTTTGCTGATCCCGCTACACCA
CAGTGGTGCGCGTGCCCGGATCTTTTGGTGACTCGGGATTTCACTGTGAGTCCCAAGAAGATGCTCAAGTTAAGATTGAGCCAGGGGAAGAGGCGTCGTC
GGAGGTCCGGTCGATGTAGACGCTGCTGAATGAAACAAGATCCGCGGATCGATGGAGTTTTGGGAAGAGATCGGTAGACGGAAGAGAGGTGGATCCGGAT
CTAGAATAGAAACATCTCTATCCTCCCCAGGTCCCCTCGGGGACCCCTGCGGATCTTGATGCAAGTCAAGGTCAGCTAACAAAACAAGGGAAAGTGAAGG
CGAAACGGTATGCATTTGCAGATTCACCGGTTAAGCCAACACCGTACCTAAACCCAAGCCCGTTAGTCGAAGAAACGAGAAAGAAGACGAAAACGAGTAA
GACTACGCGGAAGAAGATGCAAGCTCCAGAGTCGGAAGAAGACCAAGCTGGATCCAGGTCAAGCTGGTCCGACAAGGATATCGAGTTTGTGTATCGCCGC
CAAGCTTTACGCGACTTTCTGCATCAAGATCCTGTCATGCGGATCCTGAATCCACGACAGATCGAAGATCCAAGGGAACCGGTGAGAGCACCAACGAAAA
CGGCGAACAAGTTGGTGGCAGTCAAAGATCTATTACGTTTACTTACGGAGTCAGGTATCGTTGCTGGTGTGTTCGACGCAGAGGATATCTTCGAGCTAGA
CCTGGGTCTCATAATATCCGCGACGCGGGACCTCTTTGCCAGAGTTAAGTCCATTACCGGAGAAAGGTCGCGCACTATGGATCCGGTGTCGTCGCCGAGG
GTCAGCCAAGCTGCGTCCTCGAACTACGAATCCGCCGCTGAGGATGAGTCGGACACGTCGTTCAAGCCCCGACGCATGACTTTAGGACCCTCCGGGCATC
CATGCTGGAAGCGCGGGCGAGGAGCCGAGGACAGGAAGTCCCTGTGAGCGCGAAGGCTCGGGATCCAGTAGGCCCTCTGCGTGATCTGACACAATCCAGC
CACGATCGAGCCAGATCCGGCAAGAAGCCAGTGGGATTATCGTCAGATCGGGCTCAAGGTAATCGCCTCACGGATCCGGTCTCGCCAGTGGACCAGACGG
CCACAGGCTCTTCCGACACTTCCTCGGGCACCCTGCAGCGACACTTCGAAGCTGCGATGAGTCGTTTCCTGGCCGAACAGGGTATGAGAGCGCCCGTGCC
ACAAGTGCAAGTGCTCCACGAACATGGTGCACGAGACGTGGAGATGGAGTCAGTGGCGGGAGACAACTCCCATGATGAGTTCGACCCAGATGATCTGGAT
GGCCCATCGCCTTCGTCAGCGGTGGTAGCAACAGCCGCAGCCGGGGCGGGTGGATCGTCCATGATCCAGAGGGTACGGAGCTCAGCCATATCGGATCTGA
AGGAGTTCACGGGCAAGGATCAAGACGAGGATCGAGCGAGAGCATGGATCAGCATGGTCAAGTCGGCCCTCATGAGAGATCAAGCGTCGGATGCCGAGAA
GTGTCTGACCTTTG