Description :
From Genome Similarity Track
Location :
scaffold_37:261- 1379
Sequence
1118 bases(100 bases per row)
GAAGAAGAGTTATCTCGACGAGAGCAAGGATGGAATGATCGTTTTACCGTCGATCCACCACCCAAATCGAACAAAGTGCAGTCACCGGCCCATTCTCCAA
CATTTAGCTCTCCATCGACGCCACAAACAAAGGAGTCCAAGATTCGCAACGAACGTGCTCAATATGGTTTGATGATCGCTCCATTCCTGTTTTTCCGACT
GCTTGTCACTAACATACCAATACCAGGTAAACGTGGGGGGAAGCGGAATCGTGAGCCGAAAAAACCGTCAAGCGGGAAGTTGGTTCCTTTGGGCATGCTT
TCAAAGCCCCCTTCAGTAAGTTGCCATTTTTGTGTCGCTGTTTGAGTTGTTCGCGGCAGATGCTGATAATCCACTCGTGTGAAACAGGAAGCTGCACAGC
CCACCAAAGAAGAGAAACTGCGGTTTAAAGTTCTGAAAGCGATCGACGTCCGCGAGACTTTTCTGTATCAGTTAAGTGCACTTATTCTCTGTACACCCGT
GCAAGAATCACTGTTCCTCCCTTCCCGACCAACAGAGCCCCCGACATCGACTAACGCAGGTCGGCAACAAATGCGTTCAAGAGGAGGAATGACCCTCGCG
CCGACTCCAGTGAGCCGTCATGGAGGCAACTCTGGTACAATGACAAATGCTCGAGAAGCTACGAAATTGGCTCAACAACTCGCAACGGACCTGCAGGTTA
CAGGAATCCAGTGTGTCGAAGCGTTGGTTGAATGGATGCTTGAGTCTGGGGCACAGGCAGAGTACGCATGCTGGATGAGCTGTGACTTACTTTCCAAAAC
TAACTAAAGCGTTGCTGTGTCTAGAACCCCTCCACCATTCTTGTGGCGAGGGCGGAACTACTTTTTGAAGATGTTTTGCGATTTGGATTTCGCAGAAACG
GAGTTACAGGCAAGAGGAGTAAGTTTGGACTGTTTCAGACAACACAACCCCCTGCTTATTAAGCCGAACCAGAAACTAGGTCGCGTATTGGCGGCACATT
CTATCATTATGGAAATGGTCGAGTTTGCGAATGAGATGACTCCGATGGAGCTGCTTGCACTTAGTGGACGGATGCGTGATTCTTCTAGTCGAGAGGAGGT
AGAACTGAACGCTGGGGA