Description :
From Genome Similarity Track
Location :
Scaffold_147:26082- 27451
Sequence
1369 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTGGGTGGGTGTGGACCCATCCGATTCCTTTATTTAGTCCCATCAATCATGAGAAAAAGAACGGGCTCACCTGTTGAGAGCTTGA
GCAGTATGTAGTTCTGTCGACCACCGATGACAGTAGACGCATGTAAGTAATCCCTAAATTTCTTATAGTCCAAAGTGACAGCCCTCAGTCACTTAGTTCT
GATTATACTTTTTTTAGCTTAAGTCTTTAGATGGATCGTACACTACAAAATCTTTTCACTATTAAGCCCTCACTACGTGTACTGTAAGACCTGTTTTTAA
GTCCCATCCTTCAATTTGAGCCTCCCCTTAAACATAACCACATGTACCCCTGAAAGTCACTCCACAATCCCATCCCTCCAATTGACCCCCCCCTCTAACA
GAACCCCACCCTGAAGCAACTAAGAGCAGCCTTAATCGAATTCTAGAACCTATTAGAACACCACAACGCCAAAGTGATAACGCTCCAGCATGCTCTCCGC
AATAGTTACTGGTAATACACAGCATAGGTTATCATTTCCTGATCAACCATGGGTCGACAAGGCTACACTATCGGCGGGAAAAAGGAGATTGCAAGGGAGG
CGAAGAAGGTATCGTTACGATCTGTGGCCGTCAAGTACAACGTCGACCGTCGCTGCATCCGCAACTGGTTCCATTAAGACAATGCTGGCGCGTTTGAAGA
GGAGTCGCCGATCTGGTTCCGTCTTGGCGGGGGCGGTCGCCGTGTTTGCCTGTGTAGAACTGGACTCATTTGTCATCGCTGAAGCTCTTGAAGTTCGTTC
CAAGCACCTCCGGGTCACTCGTCGCCGGGTAGTGGATATGGCGGCAAAGATCCTCTGGACGATGGCAGAGCAGCCCGGCCTCGCTCTCTCGAATGGTTGG
CTCGAGTGTTTTCTTAGCCGACAAAAACTAGTATTGCGAAAGAGAACCAACAAGCCGAAACTGAGTGCT