Description :
From Genome Similarity Track
Location :
Scaffold_308:26081- 27410
Transcript NameFunction/comments
Phypl_g6778hypothetical protein

Sequence
1329 bases(100 bases per row)
AAACGAGTTGATCCGGATACCTACGGAAGctgtcgaactcgtccgacGACTGCTGATGGTTGCGTATTGTGGAAGCAACGGACAACGCGGCATGCATTTG
ATGGAAACCCACATTCGCCGGTTGTTCTACATTGGAGGTCTCGGTGGGGTTGTACGTGCCTTCTGCTCGAAGTGCCTACCTTGCCTACATGTCAAAGGAG
GGGTAGTGATTCCCCGTCCATTCAGCGAGACCCACAACACATTTTAGCGCAACGCAACTTTACACTGGGACTTTTTAACACTGGGTAATTATTTTGGTTC
GTCTCGCTACGTGTTGGTTCTAAAGGACGAAGCAACACACTTTGTGGAACTAGTGACTTGCGATGGACCTACATCAGAGGTAGCAGCTACTGTGATGCTA
GACTGGTACAGCCGCTATGGTGTACCAACTGTATGGGTTAGCGATTCAGGATCACACTTCAAAAGCAAGGTGATCACTGACTTGAGCCGGCGACTGAAGG
GCCGCCAGGAATTCATCCTAGCCAACTCGCCATGGAAGAACGGCTCTGTGGAGCGTCTTAACCGGGATATTCTGCAAGTCCTGAAGACTATTGCCTTGGA
GTGCAAGGTGAGTATGCACGACTGGTCGTACCTACTACCATTAGTGCAGTCCAGCATCAATCACTCTCCTGTCCCGTCTCTAGCCAAGCGAGCACCGGTT
GAACTTTTCGCAGGATTGGCATGCCCAAGTGCCCTGGACACGGTATTTTTTTCGGGGAGGGAAGGGCCGGGTAGCGACATTGACTCAGCCGCGACCCAGT
ACAATGCTGCACCTTGACGATTTGTGGGATGGAATCAGGGCCATGCATAAAGCCGTCAAAGCTGAGCGCACTCGACAAGCTCAAAGATACCGAGCGCgac
cccaccaccaccagcaagtgAACTTCTCTGTTGGCGACTACGTGCTACGCTCGCGAGTTGACGAGAAAACTCATTCCAACAAGCTACGTGTGATGTGGGT
CGGTCCGTTTCGCGTGATTGGAAGCGCGGACTACTACTTCACGGTTGAGCATTTGATCAGTGACAACACGATGGACGTGCATCCATCTCGTCTGAAATTG
TACGCAGATGATTCACAATGAACTACTGGACCACATCGCATCTCAAGggacgctgctggctgttgAGGCGATTATGGATTACAGACTGAACGCAGACATG
AATGCCTACGGAGTGAAACTCAAGTGGATGGGCCTCGAGTCCATTGAAGATTCCTGGGAACCACAGAAGACGATGAGCGAGGATGTACCCTAGCTACTGC
TATAGTACGCCAACGACATCAACGATGAC