Description :
From Genome Similarity Track
Location :
contig_126:26080- 31993
Transcript NameFunction/comments
g14061.t1hypothetical protein
g14062.t1hypothetical protein

Sequence
5913 bases(100 bases per row)
GAGTTCATTTTACCTACTTCCTCGCAACTACAGTGTACGTCGGTAACGGGTTCTGTTAGCCCGTTACACCTGGTAGCACTTCGTCGTCCGTTCAACGCCC
AAGATCAAGATGAACGACATCTCGAGTATGTCGTTGGAGCACGAGAACTTCCCGCACCTGACGCTGATGGAGTGGGAAGCACTCCACCGCCTGGCAGCGG
TGTCAGGCGACACGGTCGTCAAGACGCTCCTGACGACTGGAACGGAACACGAACAACGCTTGTGTGCTCAAGAGTTCTTAACGCGTGAGCTCGCTGATCT
ACGTCGGCGTGCGACGACTCCCACGCCGTCCAAGAACAAGACCGACATCGTCAAGCTCGATGTCTCCACATACAGCGGCGAAGGCAAGACCCGCCTTCAC
CTGAACCGCTGGTTCTGCGAGGTGGACATAGCGATCGAAGCTCGGCAATTGTCTACCGAGCTCGCGCGCACGCGCTTCCTGCTTTCCAAGTTGTCCGGGA
AGGCGAAGGAGTGGGCGCTCGGCCGACTCGTGGCCGACGCCTCCTGCTTCCCGACGATGGCAGCTATGCAGGCTGACCTGCGACTCGCGTTCGAGCCGCC
CCAAGATGAAAGCGTTCAACGGTCGGCATTCCTTTCGCTAAAGCAGGGACGTCTGACCATGCTCGAGTACATTCAACGCGCGCGCCATCTCGCCTCGTGT
ATCACGACGCAGCCAGTCGACATGGCCACACAAGTCCACGTCTTTGTCTCCGGTATGAATGCTGGCTACCAGCGCTTCTACTTGACCCGCAAGACGCCAT
CGACGCTGGAGGAAGCCTTCACTGTCGCTTTGCGTGAAGACTATAGTGTGTCGGCATCGCAAGCTTTCGATGTCTCACGGCCTCTTGTCCCTGACCCAGA
GCCCGAACCCATGGAGGTGGATGCTATCCAGTCCTATCGCGGACGTCGGGAGCCGACGTCGCCTTCACGCCAATCCTCCACTCGGGGTCGCGTCCTATGA
AGTGTTTTCGATGTGGCAAACCTGGCCATCGCGCGGCGGTGTGTCGTGCTCCGTCGCCCATGGCGGCGAACGCTACGACTGCGAACGACGTCGCCGCTCC
AAAAAACGGCGACGACCAGTAGGTGCGGGGCGCCCTACTGGGTGTGTACGGAGCGATGGTTCTCTGGTGGCAGAACCTCCTCCTAGCCCTCCGTGCTTCA
CGCACGCCTATCAGCCACCACATCTGGCAGCGACTCGAGACTGATCGTACTCAGTCTCCACGTTGAAGGTGCACAGCGCCCAATACGCGCCCTGCTGGAT
TCCGGCGCGACGAACAACTTCGTTCGCGCCGCGAGTTTGTCGGCATTGCCGGCGGACATGAGCATCCGCGAGAGCGGCGGTGAGATGATCGTAAAGTATG
CTGACGGGAAGCCGCGGCGTACGCCACGGCGATCTGCCACCTTCGCGTACGAGTTTGACGGGTTCCGCGGCTCGGAGGAGTTCTTGGTGATCGAGCTGAG
TGGCTCCTTCGACTGCGTCTTCGGAATCCCGTGGCTCGCTCGCCACCAGCCTGCCATCGATTGGCTCGCTGGTACAGTCCGCCCCCGCGATATCGACGTG
AATGCCGTCGAAGCGTTCCTGTGCGGAACGCCAAACCAATGGCCGCATGTTACAGTCATGGACCCCGAATCCATGGCCCATGCTGCACCCGAAGCGAGCG
ATGGCCCTTCATGTGCAGTATGCGAAAACGCAACCTGCGCCGGTCCTGAGCAGGAGTCTCAGGACGCCGATGTGGTCGAGCATGGGTTCCCACGTCCCGA
TGAGCAGTGGTTCTCGGATGAAGACGATGATGACGTGGTCGAGCATGGTTTCCCACGTCCGGATGAGCAGTGGCTCTCCCCGAAGAAGAAGATGACGTGG
TCGAGCATGGGTTCCCACGTCCGAGTGATGATGTGGTTGAGCGTGGCCTCCCACTTGCGGTCGAGCATGGATTCCCGCGGGTGGTCGAGCGAGAGCTCCC
CGAAGAAGTTGACGCGGCCGAACAGCTGGCTCCGCGTCTTGGTGCCGATGTCGAGTTCCGGCACCCCGAGTCTGCTGACGTGATCGAGCATGGGTTCTCA
CTGTCAGCTGTGGAAGACTCTCCACGCCCGGTTCGTCGTCGCGGTCGTCGTAAACCGCGACGACCTCGTGCGCCGTCGCGGGATCCAGTCGAAGCTGAGA
CCGAGATGATCTCAGTCCTGGTGGGGAATGACGCGGACGAACCTCCGCGTGCGTGCAACGTCGAGGTCGCACGTCCTCCATGCGACGCTGCCGAGATCAC
TCGACTGCCTGGCCTCTCGTGGAAACATTTCCTTCGCGACTTGAAGAAGGGCGAGATCGAACAAGTGTGCATGATCGTCGCCGAAGACGCCGCATCCATC
GCAGCCGTCGAGACCCACGCATCGGACTCAACGTCCGACGCTCGCACACGTCCGAAAGGTGCTGAGCCAAAGAACGCCCGCGCAGCACGATACGCTGCCC
AGTCGTTGCCGGCTCTAGAGGCTGCCGGCAACCCAGTCGCTCCTCTTGTACGCGAGTTCAGCGACATCTTTCCGGACAAGGTTCCAGCCGCCCTTCCACC
CGATCGTGGCGTTCGGCACGAGATCGACCTCGTGCCAGGCGCGAAGTACTGTGTGACGCGGCAGTGGCCGCTTCCCCGAGATCAAGTCGAAGCGATCGAC
GCTTTCTTCGAAGGTCGCCGGCAAGCCGGCCACGTCCGCGAGAGTCTGTCCCCGCATTCCAGCCCGACGTTCTGCGTGAAGAAAGCCACCGGCGGATGGC
GGATCGTCCACGCCTTCAACAAGCTCAACGACGCCACCATCCCGGCGCAGACGCCGATTCCGAGGAAAGACATGGTGCTCGACACCATGTCCGGCAGCAC
CAAGTTCAGCGCCATCGACCTGATGGATGGCTTCTACCAGATCTTGATGCGCGAAGCCGACGTGCCGTTGACTGCCGTCAGCACGCCCAGTGGAATGCTC
TGGGAATGGCTCGTGATGCCGCAGGGGCTCAAGAACGCCCCTGCCACCTTCAATCGCATGGTGTCAAATCTGCTCCGGCCGTTCCGCGACTTTGCGCCCA
GCTACTTCGACGACATCTTCATTCACAGTCGTGCCGCGGGCGGCATGACGGACGTCGAGATGCACCTTCAACACCTGAGGCAGGTGTTCGAAGTGATGAG
GGAGAACAAGCTGTATGCCAACTTGAAGAAGTGCATCTTCTGCGCTCCCGAGATCCCAGTGCTCGGGAGCTACGTCAGCACGGAAGGTGTCCGTGCTGAC
CCGGAGAAGATCGAAGCCATCTGCGCTTGGCCCGCTCCTCAGGATCAGAAGCAGCTCCGGCAGTGGCTTGGTCTCGCGACGTACCTCCACCACTACTCGA
AGAACTTCGCGGCAATGATCCGTCCGTTGTCGCAGCTTCTGAAGGCAGATGCCGCGTGGTCGTGGCGTCCTGAGCACCAGTCGGCTTTTGACGCGGTGAA
GACGAGCTTGTCCACCGCGCCCGTACTCATGCTTCCAGACCACTCGAAGCCCTTCCATGTCGTGTGCGACGCGAGCGACTTCGCGATCGGCTGCGCCTTG
ATGCAGTTCGATGACGAAGGGCGCGAGCGGGTCATCAGTTACCAGTCGCGCCAGCTGAAGCCGGCAGAGCGGAATTATCCGGTCCATGATAAGGAGCTGC
TGGCCATGCGGTACGCCCTCATCAAGTTCCGCGTATATCTCCTCGGCGAGCAGACCTTCGCGATCTACACCGACCACGCGTCGTTGAGAACAGCGACGAA
GAGCCCTCACTTGTCCCAGCGCATGGCGCGCTGGCTCTCGCTATTCTCCGAGTACAACTTCGTCGTCCACTACAAGCCGGGCAAGGCCAACATCCTCGCC
GACGCGCTCTCGCGTCGGCCAGACTACGTGCAGTCGGTCGACACGCAGTTGGCGACGAGGATGACGACGAGTGCGCTGTGTGTGTTGCTGAAGAGGTCGC
TGCAGTGGAAGTCGCAGCGACTACTCCACTCCGAGACCTGATATCGGCCGCGTACGAGGCGGACGCGGCGTGCTCCGAGATGATCAAGTACTTGGGAGAC
CCGTCCGACACGGCGCGGCGCCGATTGTCCGCACGGAGCCGTGCCCGCATTGATCGATACCAACTGGAAGGAGGCCTGCTGACATACAGCGTCGATCGCG
CCGATCCGCCGCGCATCGTCGTCCCGCTGGACGATGACCTTCGGGCTCGGCTGATTCACGAGTTCCATGACGCTCCCAGCGGCGGCCACCTCGGACGCGA
GAAGACTTTCGCGTCGCTCTCGCGAGACTTCTATTGGCCGCACATGTACAAGTGGGTGCGGAAGTGGGTACGCTCCTGCGAAGCGTGCCAACGAGTCAAG
CCGTCGCAGTCGAAGCAGGCCCCGCTTCGACCCCTCCCAGTTGCGGCGGATCCGTGGTCTTCCGTGAGTATGGACTTTGTCTTCGGGCTGCCTCGAGATG
CTCAAGGCCGCACTGGGATTCTCGTCTTCGTAGATCGTTTCAGCAAGATGCTTCATCTTGCTCCGGTCGCTGTCACCATCACCGCGGCGCAGTCCGCGGC
GATCTTTCTCGACATCGTCTACAGGCACCATGGACTGCCGACCTCGATCATCTCCGATCGCGATCCCCGCTTCACCGCCGCATTCTGGACCGAGCTCTTC
AAGCTAGTGGGGACGCGGTTGAAGATGTCCACCGCGTCACACCCAGAGACGGACGGCCAGACCGAACGCGCAAACAGGGTCGTCGAGGACGTGCTGAGAA
GCTTCGCCACGTCGTTCGAGTCGTGGAGCTCGTTCCTGCCTATGGTTGAGTTCGCTCTCAACAACGCCGTTCACACGTCGACCGGTCTCACGCCATTTTA
CGTCAACTACGGTCGCCATCCCCGCGTTCCAGCGCTCCTCGGCATGGAGCGCTCGATTCCCCAAGGCGGCGCTGACGACGAGAACGACTCGGCGCACCTT
TCCAATGCCGACCAAGTGCCCAGCGGCACTGAGGCCGCTGACGGCGCTACCTCCGCCTTGATGAACGGTGTCACGACTCGGCACGGTGCCCGAGCCTCAA
CTCGAGGCATGCGTACGCGTGCCGCCACGAGGGCGGCACCATCCGACATCGCATCTTGGACACGTCGGACGCTGATCAACCCACGTCAGCGTCCTCGTGC
AATTGCATATGAAGACACGTCCGGCGCGGCGACCCCGCCGCGCCGCCTCCAGCAAACTTTGACCCCATTCCGTCCCCACAACCGCGCGACACAGCGGCTG
TCAGCAAGTTCTTGCAGCGACGCCAGAGTGTGGCGCGCTATGTTCGTGACGCGATTGCAGTGGCAGTCGATCGTCAGAAGGAAAACGCTGATCGACGCGG
CCGCAAGAACATGGAGAAGTTCGCCGTCGGCGACCGCGTCTTGCTATCGACGTCCGGCATTCAACCCATTTTGGTTACCAATTTGGGCGCGAACAAGCTC
GCGCCAAGGTATATTGGACCATTTCAAGTGTTGAAAGTGTTAGGAGATGCCTACACGCTACAGCTACCTACAGCGCTCCGGCTTCATCCTACTTTCTACG
TCGGTCGGCTGCGGCGATACCATCCCGCGCTTATCCCCAGCGACGACGCTGCCACTCCCCAGCGTTCCGGTCTTGGCCCCGCTGCGGCGATTGGCGCCGC
GGCACTCGGCGACGCAGCTCCTGGTTCTCATTCTCCAGCACGTCCAGACGACGCGCCATCCGATCCAGACGCTGCGCGATCGCAGCGTCCTGTCCGCGAT
TCTCCGTTTGAGCGGGACGGCCCCGCTCCTCTCGTCGATGGTGCTGGTAATATTCGCCACGTGGTCGAGGCCATTCTCCAGCACGATGATGCCCGTGCTG
CCCCTCGTTCCGG