Description :
From Genome Similarity Track
Location :
Scaffold_214:26070- 27334
Transcript NameFunction/comments
g13814.t1ETI41139.1 hypothetical protein F443_13608 [Phytophthora parasitica P1569

Sequence
1264 bases(100 bases per row)
CGACGGCATGCCCCAGGAGATCTGGGACGACATGGTCAAGAACGAGCGCAACATTTTCTACTCGCTCATGTTCCTCAACGGGTCCGTGCTCTGGGCCTAC
TACTCGTGTCTGAGCGCGCAGGACTTTTACACGGTCGAGTTCGCCGACTCTGGGCTCGACTTCTCCTTCCTCACGACGCTCTGCACGGGCTGGCCCATGG
TCATCGGCCAGGGCGTTCAGATGATCTGGGGTCTCGACAAGAAGCTCACACAGGAGTTCCGCGTGCGCGTGGGCTACGGCATCTTCATCCTCATGGCCAT
TCTCATCATGGTCTTCAGCGCCATCAACTTCTCCAACCAGAAGACGGGCGGTATCCTCGTGCTCATCTGCTTCGGCTGCGTGGGCTTCGGCAACACTCTC
TCGGAGGCCACGTACTACACGATCGCGGCGCTCTTCCCGGTCCCCAAGTTCTCGCAGGCCGTGCAGATCGGCAACGGCACGGCGGGCATCCTCAACATCT
CGCTCGCCACGCTGCTGCGGCTGGCCGTGGGCGGCGTCCACCAGACCAGCAGCTCCACCAAGCTCGCCTTTTACCTCTTCTTCGGCCTCTTGATCGTCGT
GCTCATCGTCGCGCTCTTCGTGTACCGCCGCCTCACGAGTCTGCCGAGCGTCAAGTTCCTGCTGGAGCGCAACGCCGCATCGGCCAAGGAGGAGAACCTC
ACGAGCCAGTCCGTGGGCAAGAACCTGCGCAACCTGTGGCGCATTTTCGGCCTCATCTGGATGCCCGCCGTCGCGCAGTTCCTCGTCTTCTTCGTGTCGC
TGTCGGTCTTCCCGGGCTTCGGATGCGCGGCGTCGCGGAACCTCGCGCCTCCGTACGCGGACGTGACGCACACAGTCACGGGCTACTGGTACTGCGCGCC
GGGCATCGTGGGCAGCTACAACTACGGCGACTTCTTCGGCCGCATCCTCACGAGCGCCGCCGTCTACAAGCTGCTCAACAGCCAGTGGTGCTTCGGACTC
TCCATCCTCCGTCTGGCCTTCATCCCTCTGCTGCTCATGGGCGTGGCCGGCACGTCACTCTACTCGTTCGGCCACGATGACATGGGCGCCATCGTCTACA
ACATCGTGCTCAACCTCGTCATCGGCCTCTCCAACGGCTTCCTGTCCACGGTCACCATGGGCGTGGGCCCCCGGATGCTCAACCCGGAGGATCGCGAGTC
GGGCGGCGCCGTCATGGTCTTCTGCCTCTTCCTCGGCATCGCCGGCGGCTCCACGCTCGGCTTC