Description :
From Genome Similarity Track
Location :
Scaffold_815:2607- 3748
Transcript NameFunction/comments
Phyag_g8183hypothetical protein

Sequence
1141 bases(100 bases per row)
CATTCTCAAATTTTTTACCTTCGTATCAAGTCGTTCAAGCGGTTCAAGCGTCTAGAACACCCCCGACAATCAAACAAGCCGCaatgcagctcttcgtccc
GCTCattgcagtttttgcttTGTTTTCTTCTGGCACTGTGGTTAAGTCCAGTCCCAacgaggagaccaagacTATCGATGAACTTtacgctgacgctgtc
gcgGAAGGTGGCAACCTTGTTCTCTACCACGGCGGTGATACTCCTACCTCGCAGGACTCTCTCTACGATGCCATTGAGAAGCGCTTCCCGAAGCTGAACT
CACCGCTGTCGTCGACTACAGTAAGTACCACGACGTGCGCATCGACAACCAGTTGGAAACCGAGACCCTGGTACCcgacgtggtggcgttgcagatgctg
caggactTCACCCGTTGGGCGAAGACTGGGGACCTCCTCCCTTACAAGCCCGCTAACTTTTCCAAGATCCATGACACATTGAAGGACCAGAATGGCGCGT
GGTTGGCCTACTCGATATATTCGTTCAGCTTCATCTACAACTCCAGCGCACTCAACGGTTTGGCGGCGCCTACGACTCCGGCCGATTTGGTGGACCCGAA
GTACGCTGGTAAGATCGCTTCCTCCTACccgcacgacgacgacgctgtgtTGTTCCTGTACACTCGCTATGTCGAGAAGTATGGCTGGGACTGGATGACC
CAATTGGCTCAGCAGAACGTCAGCTTTAACCGCGGCACGAACGTCGCTCGTGACCTTGTGAGTTCGGGGGAGAAGGCCATTGGCATTGACTCGAGCGTCC
GCGGCAACGCCACTACCTTTGTCACCAATGGCACCGAGTACCTGAGCTGGGGTCAGCGCATGGGAATCCTATCGAAGGCCAAGCACCCCGCTGCCGCCGA
GCTATTCATGAACTGGATCATCTCGGAGGAGGCGCAGACGTCGTTGGTGTCCAACAGCCCGCGCACAGACATCAACGCTAACAAGCCTTGGGACGTTCCG
GAGGCCAACATAGCTGCCTTCCCGCCGTTCATGGAGGACCGAGCCAAGGTGGAGGAGTGGAAGCAGACGTTCGCTCTTTGCTTTGGTGAGGTGCAGGGCA
AGCCCAGCCCTGGATGGCTTGGCCTGCACCCTGAGCAGTAA