Description :
From Genome Similarity Track
Location :
scaffold_6:26062- 44200
Transcript NameFunction/comments
Pl_112751HSF-type DNA-binding protein, putative
Pl_112752hypothetical protein PHYSODRAFT_309064
Pl_112753hypothetical protein PHYSODRAFT_468056
Pl_112754hypothetical protein PHYSODRAFT_554409
Pl_112755hypothetical protein PHYSODRAFT_321823
Pl_112756hypothetical protein PHYSODRAFT_343735
Pl_112757U4/U6 small nuclear ribonucleoprotein Prp31
Pl_112758hypothetical protein PHYSODRAFT_475074
Pl_112759hypothetical protein PHYSODRAFT_293744

Sequence
18138 bases(100 bases per row)
CAGATTACAGCGCTACGATCATATTAACTAGTACTAGTAATTGTTTGACAATGTGGCAAGTTGAGTCGGGCTTCGGTCTCCCAATGTGAACCTTCCAAGA
TTCACTGGGTATACAAGAACTCATTTGTTGCATGCTGCAGCTTGCAGCAGCGAATCTCCACGACAAATCGATAGGAAACACTGCCCTGTCATTAGCAAAA
GGAACCCTGAGGTAGCCGGTCCAGCCATGCAGACTCACAAATTGGTCGCCGCTCGAAATGAGCTCTTGTTGAGTGGACATTAGGTATCAAATGCTCAACA
GAATTCTGTGATCATGTAGCTCGCATAGTTGCTTGCATAGTTGCCATGCCGGTTGCCACATTTTGCGTTTTGCGTTTGCCATATTTGGTTCAAAGAACTG
GACTGGTTTTGTCGCACGCATCCCTAGCCCCGCAAGATTCTCTGGTGCATGAAAGCATTCAAGCCTGGTTTATTTCTCGTTAATCGAATCTAGATTCAAA
AAAAGAAAACCACTGCGCTTGGGTATGGCTGCCCGAGAAACGCGCTTCGCCGTTCTCACTTTCGATTCCGCCCTGTCGAGTGCAAGCACATCATGAACCT
CCAAGACCTCCTCTCCGAAACTGCCGAGTGTCCGCCGTCGCCTACTCTTTCGGTCAGTAGCTGCTCGAGCTCGAGCTCGAGCTCGAGCAGCTCGGAGGCC
CCAAAGCGCGGTTGGGTGGCTCCTTTCCTGCTCCACCTGCACAAGATGCTGCAGCACGAGGACTCCAAGATCATCCGCTGGGCTGAGGACGGCATGGCCT
TCCAGATCCTGGACAAGGAAGCCATGACCGCGCAGATCCTTCCCAAGTACTTTAAGAACAAGAACTTCTCGAGCTTCCAGCGCCAACTCAACTACTTTGG
TTTCCGCAAGTGGAGCAAGGCCCGAGCACAATTCCCTACCTACAGCCGCGAGCACTTCACACGTGACAACTTCAGCGAGATGTCGCTGGTTAAGCGCCAG
AGCAAAAAGTCGCGAAAGCGCAAAGCCTCTTCAGACGAGGAGCAGCCGCCCAAGCGCGCAGCTGTGGCCTTGGCTACTTTCGCCTCGGAGAAGTGCAAAC
CCATTCTCCCGCGCCCTGACGCTGTGGCTGTTCCAGCATCATACCAGCCTCAGACCATGTCTCCGCCAATGCACTCTGCACCGGTGTTCCACCTCCCTGT
GCTGTCTCCCACCCGCAAGATCAGCAGCGGCTACAAGCTCCCGTCCATCCGCGAGCTGTCGCTGTCCAGCGCAATGCCGTACGCGGTGATCAGCCCCATT
AGGCCCCGCCTCACGGCTTAAGTGTCTGTCGCCGTTTGTATTTTATGGTTAACTCAAGCAACATTATTTATACAATCCACTTCCACCACATTCAGTCTTC
TGCATTCCAAGTCCGGATAAACACACGGGACATTTCTTTCAAACGTCCCGTATATCGCTAAAATCGTACTTAGTGGAGGCACGCGACCGCTGAGTGATCA
TCGGCACCACTTCAAGTTTCTCTCTGCAGAGGACGAGGCATTCGACAGACACCTCTTCGCGGCCGTGTTCTCATGTCGAAGCTGCTGCTGCTTCTAATTG
CGTTACCGCTGGCAAAAGCATGCACGATGATCGCGGTGGGACGCAACGCGACGGTTGACGGCTCCATTCTGGTGGCGCATACGGATGACGCAGGTTTCGG
GGCTGCTGACCTTCGGATGGTGCGCGTGCCAGCTCAAGACTACGAGGAAGGAGCGATGCGGCACGTGTATAACGTTCAGCCAGGCTATCCGCGTATCGTG
ACGACCCAGCGAGGACCCGAGTACAAACCCAAGAACGACCAAGAACAGCTCATGACGCCACTTGGGGAGATCCCGCAGGTGCCACACACGTATGGCTACT
TTGACCAGGACTACGGCTTTATGAATGAGGTGCAACTGAGCATTGGAGAGAGCACAAGCGGCGCCAGGACGGTTGGCTGGCCCAAAGACGCTGGCCCGCA
CGGATACAATGTGTTCGGGATTGGAGAACTCACCAAAGTGGCGCTAGAACGATGTGACTCGGCTCGATGTGCCATTCAGACCATGGGTGACTTGGCTGTC
AAATACGGATTCTATAGCGAAGACAGTGGTGATCCAGCCAATCCAGATTACGTGAGTGCCGCGGAGACTCTGGGTATTGGAGATCGCTACGGCGAAGTGT
GGGTTTTTCATGTCCTGACGGGTCCACAGAACACTAGTGCTGTTTGGGCTGCCCAACGTGTTCTAGATACGCACGTGGTCGTGGTGGCTAATGGTTTTGT
GATCCGTGAGATGGACCTGGATGATCCAGATCACTTCATGGCATCAGAGAATGCACTTTCATTTGCTGAAGAGATGGGGTGGTGGGACCCGAAGCAAGGC
AAGTTCGATTTCACCGCTGCATACGCTGCTCCAACGCCAAACCCCGTACGCGCGTTGTATATGGGTCGTCGTATTTGGCGCGTGTATGATCTTGTGGCAC
CGTCCTTGCAGTTAGATTCTCGCCTTGGGCACTATCCAGAGTTTTCAACCTATCCGTTTTCGGTTGAACCGGACCGGAACCTTGATGTGTCGGACGTCAC
ACGGTTGTTACGTGATTACTTTCAAGGCACACCGTACGACTTGTCTAAGGGCCTTGGTGCAGGACCATTCGGGAATCCTATGCGGTGGGGAGGCGACGAG
AAGGGAGTCGTAGGTGGTTGGGAACGACCAATTTCCATGTATCGTACTGTCTTCAGTTTTGTGCTGCAAGCTCGTGCTCACCTTCCTGATGCAGTTGGTG
GTGTGGCTTGGTATGGACAGAGCTCACCGCATGCCACAGTATACGTGCCATTTTCCTGCGCGCAACAAGAAGTGCCACCCGCATACGTACTTGGCAAGGA
AAGTGAGTTTGTACATGGATCAGCCTGGTGGGCCTTTAGCTTCGTGAACAACTGGAGCATGTTACGTTTTAACGCTATTAGCAAGGACGTTCGTGCTCGC
ATTGCTGAGTTGCAGAAGACTTGCTTTATCGAAAGGAAGGCGATGGAGCACCATGTCACTCACACCAAGTCGTTAACCGCATTGGACACCCGCGTGTACT
TGCAGGAGCAAACTAATCGATTGGCTTCGCGAGTTATCGAAGAATGGTGGACCTTTGCATGGAAGCTTGTGGGCAAATACGCGGACGGCTACATCACCAC
GGGCGAAGCTTCAGAAGAAATGGAGATGCCTGGTTACCCAGAATGGTGGCTCAGACTTAGCGAATTCTCTAAATGGCCAGGCGAGACGTTGGTGCCACCG
CATATTCCAGCTTTGCAAAAGCAGCTCGAATTGTTTGAAAGACGTCAGAACGTGAGCGCCGAACTTGAGACGCAGCAAACTGACAGTACATCGTCTTCGA
GCACTTTTTTAATTCCTCAATTTGGAATCGGTGCTGTTGTTGGGGCTGTTATGGGTGCTTCCGCGACTTGGTTTGTTACGGAGCGTCAACGGCGATCCGG
ATACCAGCCCCTAGCTTAGATGCAGATCGGGTGGATGAAGAGTTCGCATGCTTATAATTTTTTAGGTGTTGGATCTAGCAGAGCTCCGACTCCTACGGTC
GGTGAAGGTGCAGACAGATTATGAACTGCACTAACCTGCTACAAGAACAGAAAGTACCCACAGGTATTTTTCAATCGTACGTGTATACCGCTTACCTACC
ATGAAGATTAGTATCTCTTGTGCGGTTCCTTGTAGTTGCGTTTGTTTGCCGGACTCGAAGAACGCTTGTGTCCATGAGAACGTCCTTCACGTCTGTTGTT
GGGTGAGGAGCTTCGGTTGCGGCTACTCTTGAATGCCTGCTGACTTTGTAAAGTCTTGGTGTCATTGTCGCTGAACGTTCTCCATAAACTACCTCCTTGT
TTTCCGTTGCCTTCGTAGTTATCCCGTTTCTTGCGTCCGTGAATCGATTCATAACTTCCCCGATTTTCGTTGGTAAATCTCTCGATCTCTCCCGGACTTC
TTGACTTGGATCGTCCTGCTCTAACAGGCTTGGAAGCGGCGGTAAGGCCTGGAGTGCCCATTAATCCCATCGCTCGCAATGTCTTCTTCTGCAGCAGCGG
GACTTTTTCTAGTCCAATGAGCTGGCTGTAGAGAGCACCCGTTTCAACAAGCTTCGCCTTTGACATACTCAGCTTCTTGAGGTTCGAGTTGTAGAAACCC
AAGAATGCAGCGTAAGCCTTCTCAGCCGATTGTTCCAGATCACTGTGAGGACGAACATTTACAAGGGCCCGTGTAGTTCGGTAGTTGTGTTGATCCAGCT
GAGGACGCTGCTCAAGTTCTGTAAGCGGCAGGTCAGCCAGATCACGCAGCATGGCCTTTTCAAAGTCGGCCAACACTAGAATACCACGCCCTTCCATACC
AGCGCGAGCAGTTCGTCCAAGGCGATGAATGTACTGGTCACGATCCGTTAAGCCCACTTGCAGTACAAGCGATACATCTGGGTAATCAACTCCACGCGCT
GACACGTCAGATGAGAACATGATCATCTTCTTACCCTTACGGAAGGCATCGGCGGCCTTGGTTCGGGCAGATTGACTCTTGCGTGAATGCATCTCCAATA
CGTCCTTGAAACCCGCAGCTTGAAAAAGTTGCGCCATGAACTGCGCAGATCGTGCAGTGGGTAAGAATACAATAACCTTGTACGCCGGCAACTTCATGTG
CTCTTCTAGCACACCTTCCACAACAGGAATGACGTCTTGCAGGTCACAGACAACATATTCTTGCACAGCTTGTGTGTTTGTCTGTTGATCATCACCTTCA
ATCGTATCCACAAATGTGTAGTCGTCCCGCAGTGCTACATCCTTAAGTTCTTCAGTGGCAACCGGCAGCGTCGCGCTAAAGAGCAACGTCTGTCGCTCTT
TCGGTAAATGGCTGATGATCCGCATAATATCAGGACGGAATCCCATGTCAAGCAGTCGATCAGCCTCATCGAGTACAAGGACCTGAAGATTGTCGAGCTT
CTGTCTGATGCGTCCACTATTTTCCTCTAAATGCGCTTGCAGTCTCCCCGGAGTGGACACAAGCACATCGATACCTCCAGGTTGCGTCAGCTCCTTGACA
TCTTTGTTCACTGCACTACCTCCCACAAAACAGGACGTGCGTAGTCCATGGGCATCCGTGAGCTTCACCGCTTCGACTGCGATCTGTTGTGCCAATTCTC
GAGTTGGAGAGATCACAAGAGCCGAAATCTTGCCCTCTTTAGGCTGCGGGTACTTCAGCATGCGCTCCAATGTAGGCAACAAGAATGCAATGGTTTTTCC
ATTGCCCGTCTTGCCCTTAGCCAACACGTCGCGACCTTGCAGTACCAATGGCAGCGTGTCCTTCTGCACATGTGTCAAGAACTCGTAGCCCATTTCACGA
GTCAATACATCCTTGGATCGCTGGCTGATTGGCAGAGACGCAAACGAAACATCAGACAAATAACCACTAGAAGTCCATGGGACGAAGCTCGAGCGGAATC
CATGCGCAGTAGCTCCACGCAACAAGGTCGACGAGATGTGGCGTGATGTCCACATTGTCGAATGGTAGGTCTCAGACAATAGCGGTTCGAGCCCAAAATA
ACCTCATTTCGGTATCTCGAAATATATCGTTTTAGGTAGATGATATTTTTACACGGCTGAGATTGGTTGAAAATAACACAGAAGCCCTAGACTTGGATCT
TAATTTGGGTTCCCGCTCATTGTCCGATTGACGACAACCTGCACACTAAGAAGACCCGAGCAGTGACAATGGCGCTCGGACTGCTGCGTGTATTGGCGGC
ATCTCTCGCTGTGTTGGTAGCGATGTCTACTCCCTCCGACGCTATGATTGTGAAGCTGGATGGACGAGTGGAAGAATGTTTCCACGAGTACGTACGTACC
AAGCGCACGGCTTTCATGAAGATTGGCGTACTGGAATCCACAGGCGCCTACGACGTGCGACTGAAGGCGTTCGGCCCATTCCCCGAGTACCCAGAGCAAG
AGCAAGTGGACAAGAACTTCTTTGACCAGTTAGTGCTCACGCCCCATGACGAGGTGAGCCAGAATGTCGAACACAGTGGATTCAACTTCGAGTCAGAGCA
CCGCGGTGGATGGTATCGCTTCTGTCTGAACAACATGCACGACGGCCAGATCAAGACGATCGAGTGGTACACGTCCTTTGATCTATCGAATGAGGATGAT
CTAGGTGAGGAGGACAAGCTGGACGCGCAGATTCGTCAAGGTACGTCTTCGAATTGGAGGATGGAGGGTTGGAAGTATTACTGACGTTTTTACTTGGTGG
TAATAGAGCACATGGAGGGCGTGAAGACGTCGCTGGACCGATTGCAGACGTTGCTGAAGCTCATCCGTAATGAACAAGACTATTACCGTGCTCGAGTACA
CCGCCACGTTCAGAGTAAGCTTCATGTTGATAGATTTGCGCCGTAGTGATGCTGCTGCATGAACTAACGTGGTTATTGTGGTATAGCGATCGAAAGCAGT
AAGAACCGCCTCATCTACTACACGGTGTTCGAACTGGCTGTGTTGGGCGCCATGTACGGTGCGCAGTCCTTCTTGCTTCACAAGTGGTTTAGCGATCGCG
GATATCTCTCCAAGCGTCAATGGGCATAAAACTACAAGGTGGAAGTGCATCATAGATATAGGCAACGTTGTATTAACGTTACTGTCTTTGCAGCTAAAGG
GAAGGATGTGCCTACAAACTTAGCAAAAGTCATTGAAAGCAGTGGCGTTAGAGACTCCCAACACCAAATACGTTTTTGTACCCCATCTTGTTTTATTTGA
TCCACGATAATTATTCTTGCTGCTCGATCTATCGATTAATCATCCAAGACATCACTTTCGACCTCCAGCTCATTAATAATTTGTTGGCAATGACGTCGAC
GCTCTTCAGCCGTACTTGTATGTCCAGCAGCAGACACAAATACTTGATATGCAGGTTCACCTGCACTTCCCTGTTTCACCGACAAATACAACACTGTGTC
GTTGTTTGGCTGTACAGTTGGTACAAAACGATACCTTCCCCGTTCATCCGTCAAGATGCCTTGGATCGGACTGAGATCCAGGAGCTCCCTCACATCTGCT
AACAGACTTCTATCCGACGCCACTGACACTTCATCTGGACCTGGAAGAGCCCCCTCCTCCCCATTCTGCACAGCTTGGAACTTGCCTTGTTGGAAGTAAA
GCACACGGAACGACGAACGTTTCGTGAGTGGCTGCTGCGTGCCAGGACTGATGCACTCCAACTCAATAAAGCCGGCGATGGGGCCCTGGAGGTCTCGAAT
TGAGGCTTGAAGCTGTACTCGCTGTCCGGCAGCCAGTGAATCAAGCGTTGTAGAGAAGAGATTTGTCTCTGAGTTGCTCAGACGCACATTGATCTTCGTC
TGGCCCAACATAATCTGCGAACGGTTAACCAGCTCAATGAGTAGAGCTCCAGTGACGTCGTAACCAGAGGATATGTGGAGGTTCTGCAACATCGCCGACT
CCATCACTTCGTTCATCATGTGCATCACCTGCGCACTCTGCGATAAGCTCTGCCCCACGCGCTCAAAGACCGACTCAAACGACTGCTGTAGGCCACCCGC
GTAGTTCTCTAACATCTGAGCCATCTCGTCCATCGTTGCAATTGGAAAGTGTGCAATTTACAGTTCTAGACATGGCTACACATGGTCAAGTTGCTGTTAT
TGGAAAACATTTCTAGTCAACTGACTCATCCTTCGTTGCAATAAATTACGATTGGGTTCTAATGATGAGGAAATCCAGTTGCCGAGATAGGAACGAGTTG
ATTAACTCAGCGCAGCGACCGTGGTGACTTATCTGCGACCAAATCCACCGCGTCTGCCACCGCCACCGCGACCGCCGGTCATGTTGCTGCCGTTGTCGCG
TGTGTATGGCGACGGCTCAATGCCGGGCACACCGAGGAGGTTCATCTTCTTGAGGGTCCTTTTCTCAAGCTTCGGTACCTCTTCCAGGCCGATGATACGG
CTGTAGTCGGCTGCAAGCTTGACGAGCTCGACAGGCTTGAGTTTCAAACGTTTCGAGTTCGAGTTGTAAAAACCAAGCCACGCCTGGTACGACTGCTGCG
CCGACTTTTCCACATCATTGTACTTCTTCAAACTCTTCGTAACGTTCAATGTGCGCGACTGGGATGGTTCCAGAATCTCAGGAGAGTAATTTTTGCTCGG
CTCCAGAGGCAAATCACTCAGCTTGTCAAGCAGTGGAGTCTCGAACTCAGATAGAATGAGAACACCCTTGCCCTTCATACCAGCACGAGCCGTACGTCCA
AGGCGGTGAATGTACTGGTCACGATCGGTGAGACCTACCTGCAGCACGAGTGAAACATCCGGATAGTCCACACCGCGAGCCGACACGTCCGACGAGAACA
TCAGAATCTTGTGGCCCTTGCGGAAAGCTTCAGCCGTCTTCGTGCGTACTGCTTGACTCTTACGCGAGTGAATTTCCAGAACACCAGGGAAGCCTGCAGC
TTGGAAGAGCTGCGCCATGAACCCAGCCGAGCGAGCCGTCGGGAAGAACAGCATCACCTTGTACGCCGGCAGCTTCATGTGCTCGTTCAGCACGTGCTCC
ACCATTGGGATCACCTCCTCCATCTTGCATACTACGTACTCCTGTTCGGTCTGTACGTTCGTGTCGGCCTCGTTTTCATCAATCGTGTCGACAAACGAGT
AATCCTTACGCAGAGCGACTTGCTTCAGTTCCTCCGTAGAAACAGGTAATGTAGCACTAAAAAGCAGCGTCTGACGCTCCTTGGGGAGGTATCCAATGAT
GCGCATGACGTCGGGGCGGAAACCCATATCTAGCAGTCGGTCGGCTTCGTCCAGAATCAAAACACTAGACTTTCCTAAGCGGTCAGCAATTCTGCCAGTG
TTCTGCTTCAAATGGTCGACAAGACGTCCCGGTGTAGCAACCAGAATATCAATCGGCGCACTGCTAGTGAGCGCACGCTCGTCCTTCTTAATGTTGGCAC
CACCCACAAAGCACGCAATGTTAAGATCCTGGAATTTAGTGAGCCGTTTGGCCTCCGTGGCGATCTGCAGCGCCAGCTCGCGCGTGGGCGAGACGGCCAA
AGTGGGGATGGCGCCGGAGCGTCGTCCCTCTTTGACCATGTTCTCAATCACAGGCAACAAGAAGGCAATCGTCTTGCCGTTGCCAGTCTTGGCTTTAGCC
AGCACATCTCTTCCCTCGATAATTAACGGGAACGTCTCGTTCTGCACGTTGGTGAGACGCTCGTATTTGAGGTCTTCGACAATGGCGCGCTTCGTGTTGG
GCGAAATGTCGAGCGATGCAAACAGCACGTCCGACAGGTAGTCCAGATTTGCAGGTTTGGCAGGAGAGGTCTCGTGCTTCACAGTTACAGCAACTGGTGC
AGGTTCTTGGCTGCTGACATTTTCCTTGGCGTTAGCGTTCTTGTTGTTGCGACGACCGCCACGACGAGGTTTCTTCTTCATGTGCTCGGCGTCGCTGTCC
TTGCGTCCTCCAGCGGGCGTCTTGCGGCGCCAGTTGTGGCTGTTGCTACCGTTGCTCTCTTGTCCAGGCATGTTCGGGTCTTCTTGTGGCTTGAATGGGT
GCGTAGCAGCTGGAGAATGCGAAACTGAAGCGACTGTCTCGATCTTCAGAAGTTAAACGCTTTCCACCAACGAAAAGTGCCGCTTCGAAGACGAAAGACA
CTTGGAATTTGTATGCCTCATTTATTCAGTACATGTAAATGTACTGATAATAGATATTACAAAGGAGTACATATCACTCTTTTCCGTCAAGACGATGGTC
CAAACAGCACATATCCAAGCCATTCATACGGTTAATTCGTTCGAACGGCATTTAGGACAAGAAGGAGAAGGATGTCAACGCTCGCGGACTCGTTCCTGGA
GGACTTGGACGAACTCAGTGGAGGCAGCAGCGACGAGGAAGAGACGCCGACGTCCTCCTCCATTACTGGCGTCGCTTCAGGTGGCGACGATGAAGCGCAA
GGCGACGATGACGACGAGCAAATGCCCGAGAGTCCAAGAGCACAGTCGAGACCAGCCAAGCGCAAACGACCAGAAGATGTCGAGCAGGATCTAGAGCAAA
AGACTGAGGAACTGGCCGAGTCGCTGCGCTCCAGCGTCAAAGAGCGCGGCGTAGCTGCCGTCGCGACGCTCAAGCGCTCACCCAAGTATTTGGGACATGT
ACAGAGGATCCAGCAATACGCAGATGTGGACAATGCCTCTACAGCCAAGCCTCAGCCACTGGAAGAAGGCAGTGTTGAGTATGATCTGGTGGTGACGTCC
AACGACCTAATGGTGCAGATCGACGACGAGATCGAAGCCGTACACCGCTTCATTGCTGAGATCTACGTTTCTAAGTTCCCTGAGCTCGACTCTCTTGTGC
CTAATGCTCTTGACTACGCCCGAGTCGTCAAAGCTATTGGCAACGAGATGGATCTGACACTTGTGGAAGAACTGCCGAAATTGCTGCCTAGCTCAGCAGT
TATTGGAATCTCTGTGACAGGATCAGGTACCAGTGGCAGACCACTCGGTCTTGAAGACTTGAAGACATGTATGGAAGCTTGTGACGAGCTGCTGTCGCTG
GATAAGGACAAGAACATGATTTTGCGCTTTGTTGAGAGCCGCATGAAGTACTTGGCGCCAAACGTGTCGCAACTTGTGGGAACACGAATTGCGGCGCAGC
TTATCGGACTTGCTGGTGGTGTAGCGCAACTTGCACGAATCCCGTCGTGCAACTTGCAAGTCTTGGGACAGGAAAAGAAGGTGTTGAGCGGGTTTTCGTC
CACTGCTGCGCTCAAACACACAGGTGTGCTGTTCTTTAGTGATCTTGTGCAGAATGTGCCGCCGTATTTACGAATGAAGGCATGTCGAGCAGTAGCTGGC
AAGTTGGCGCTAATGGCGCGCGTTGATAGCCAGCCACATCAAAATGACATTGAAGGTCTAGTGGGGGCGCGCTTCCGTACCGAGCTCGTTGCTAAGATGG
AAAAGTGGCAGGAGCCCCAGAAGGCGAAGACGAAGAAGGCTTTACCGATCCCTGACGAAAAACCGCGCCGCAAACGTGGCGGCAAGCGGTATCGCAAGAT
GAAGGAGAGACTACAGATGACTGATGTGCGCCGTGAAATGAACCGGCAATCTTTCGCTACAGCTGACGAAGAATATGGTGACAACGCCATGGGAATTACT
TCTGGTCGTCTTGGACAAGAAGGATCGGGAAATTTACGAATTATGCGCAAGGAGCAAAAGCAGTCGAGCAAAAAGCTGCGTGCTGCAAACTTTGCTGCGT
CGTCTGCAAACAAGCCGCCACTTTCTGGGCTGGCCTCAAGTCTTGCCTTCACGCCCGTGCAGGGTATCGAACTCATGAATCCCGAAGCTGCAAAGGCGCG
CGTCGCGGAGGCTAATAAGAAATATTTCTCGGCGGCCAGTGGATTCGTTAGTGTCGTTAAGAAGCCATGAACTTGTCGAAGAGAATTCCGCATTATAGAT
CCGTTCTCGAGCAAGGATCATCAAGTATTCAAGTTGAACCTGGTACTTTGTCCACATTATAGATCCGTTCTCGAGCAAGGTTCATACAAGTATTCAAGTT
GAACCTGGTACTTTCCTCCATGTCCTCGATAGGCAGAACTACAGTAGCTAGGTACTGTTTTCATTTATTGAAAACCTACAGTCAAATTGCTCAACTGTCC
GTATCCATTTCATTGAGTAAACAGCGAGAGCTTGCCGTGCCCAAAGCTGAACTCCAAAGATGTATCGTTCTTCATTTATTGGAGATATGATTTTCTCGAA
TTTACAGGGTATAGGTGCACACGTGTTAGCTAAACGTTGTCAAATCTACGCCAATTCGATTATCATTGTTAGCTCAATTTCGCGTAGCCGGCACCGTCGA
TGGTGACCGTGGTCAAATTAGAGAAAAATAAGTCAGCGATATCTTCACGGTCTCCAAAGACATTGGCCAACCAAGAAAATGAGGTTCCCCACCCTCCCAC
AAATCAAGAGGTATCAGGGTCGTCACCGAAATCCTACAACCCATTGTTTGCGAGAACTGGTTACCAAACAAGACCCAGAAAAGTGTTCCGGTTGCGATCG
ACGAGACAAAAAGCATTTTTCATAGGTTTCACGCGATCTTGTATGGCGAATTAACTCCCTCCTCCTCACAACGCGAATGTGAAAATAGGAAAGAATTTGA
GTACGTGTTCGAAGAAGTACAATATTTGTCTACCGTAGATGTTTGATACATTGGAAATTAACAGCCTCGGGAAATGTACGGATGCAGTTATTAAATCCCT
ATGTGGAAATCAATTTACGATGAACAAGTGCGCTGCACACAAGAAAGATTCAAACATCGATCAGAATATCTGTTGATACATTCACGCACTTTCGCTTTGA
AAGTTGTCAATATTGAACTCAATGTCGTTCAAAATGGCGCGAGCTTCTTGTGGATGGCCAGGTAACAAAGCAATTCTCAGAGTTTGTTGTGTATCTCCTT
ATTTTTGCTGCGATCAGAGGAAATACTCTTCATACTTCTGCTCGTAAATAATGCAGAAACGTTTGTCCGGTGTGCGACGGACGCGATGTAGTGTTCCTGG
AATCCGGCCCTCCGTGGCTCTATTCAACGCATGGCCACAGAAGAGCACAATCTCCTTCCCAGGGATGCACACCTTCTCAGCCTTAAGCCACTGTTCTGAA
TGTGGGTCATACACATCCAGCCCCTCGACACTAGGTACAGGTTCCACCACGTACAGACTCGGGTCCACGTGCTCAAAGACGTTCTCCGTCTCAGATTGGC
CACTTCCCTCGATGTTCGGGTAGTGCAGGCCATAGCAGACAGAGTAGTCCTTGTCAGAGCGCGCATGGCTCGGTTCAATATCATAGCCGACAGTTAAACT
CAGGGCTCGGTCGCAGATGCGCTGCATACGGCGCTGTAGAGCTAACCAGTGGTTCTTAAACTCTGGTGATGGCCACACCAACCTCGACATGTCCCCGCAA
GCCACCCGGAAACAATCACGCACACTCGTGTGCTCGTATCCAGCGTACCAGAACGGTTTGCCGTGCTCGTTAAGGTAGATATGTTTGCTAATGCATCCGT
TCTTCCAGTCGTCATCATCGCTAGTGAAGAAAGTCTCGAAGTCCTGCAGTACTTGGTCATGTGTGCGCTCCAGTGTCTTGCCCAAACCTGTAAGCACCAC
AAACGAGTGGCGCTCCATCATCTCCAGGAATCGACTGCGGTTCTTCCAGTTGAGTTCACTTAACGGTAGACGTGGCACTTGAACAGTATCACTGGGGACG
TCTTCAAGTTTTGTCACAGTCTCACTTGACTTAGGAGTCTCAGGGATGGTGGTATCCGAAGCGTCTTCGTTGCTTGCATTGAGGCAATAGTAACTTGCTG
CCAAGCTGTAGTTGGTTGGCATGGAGAAGGTGGTGGCAGGCAATGACCGAGTCATGTCGGAGGATAATACCAACAATGTCTACGTAGTGCTAATCATTTC
TTTGTGTCAGCCACACGTTTTGGGTGCTCACAGCCAATCAGGAGCGGTGATAGAAAAGTTCAAGTTTGGGACCATCACTCTGCTTAGAGTGATGGTTTTA
TCGATGCATCTAGCAAGATATTGGGGTAAAGTGTGTTACAAATATTTATGGTATAAGTTATCGTGGTTGGCACAAAAAGATACAGCTTGACAAGCGAGAG
GATACGCAGGAGATGCGAACACTAATCGCTTTAGACGCGGGTGTGGCTCGATTCTGAGCGTCTTCGCGGTACCGTTGTCTTTGACTTAGAAGGGAGCGCC
TGGTTGCTCACTTGGAAGTCAAATAGTCGTGATTTCACCTGATCAAGACGACCTTGCCACTCTGGTGTGCATGGCTTTCGTGCAGTATTGTTGGTGAGGT
GCTTCGTTTTGTCAGCGGTGAGGTTGCGGTTGCGTTCTTCTAGCTGGCGACGGCGTTCCATGTTCATGGCCTTTGTTGCTGCGAAGCGTGGCGAACTATC
GTAGTCCATGTACCGGGGGACAGACGACGACTTCGGCCGGCTTCTTGCACACGAGGATGTAACCACAGTTGGAGTACTCCGTGCTGTTTCGGTAAAATGA
CGAGTAGACTTGGCTGTCTGTGGCACCATCGTGGTCGAGTGTGAAGAGCAACGAGATCTAACCGGCTTTGGTGCAACGGGGACTGCGTTCTTGGAAGAGC
GTCGCGATTTAGGGACCGGAATCGACGATGTCTTCCCGGTCAGCGAAGTACGCCGGTAGGACGTGGGTGGGACCCTGGAGGTCTTCGTCGATTGTAGGCT
TTCGGGAAGCGACGAACGCCTCGAGTGGTTGACGTTGGATCTGACAATCTTAGGCATCTCAGGGCTAGATTCACCTGACGCCCGCAGTAGCTCAGGTAGG
AAGATATCCAGCGAACTGAGAAGCGAATCCAAAGACCCAGTAGAGGCAGTGGAGTATGCCGACGGACTGCGAGGAACTGTCGAGTAGTAAGTGGCCTTGG
TCGTAGTCATCGAATCTGTATCGCTCTCGTATGGGTAGTTAACGTCATCGTCGGGTTCTGAAGTCTCGACATTGAGGGTTTTGTAAATAGCAGCTTTTGT
TGGAGTCGACTTAACGTTGGAGATCTCCACCTCCTCTTCTGCAGGTTCTTCGTCTGGTTCTGCTATCTCTTCTATCTTTTGGGTCAATTGCACAGGCTCT
GACTGCGTATGAGTACGCTGCATGTTGATGCGTTCGATGATTTCCTTCACTGGTGAGTTGTCGGACTTTGGTTGCGGGGGTAATACACTCTTCATGGAGC
CTGACACAGACCAAGAGCGCGGAGCTGTTGGTGCGGCGTTGGACTGTGCCATACGCTCGAACTGGTCGATCAGAGACTGCACTCGTTTGGTTGCAGAGCT
GTCCATTGTATCGGATTGAATTGACGAGTAAATAAGACGATACAAGCGTTACAGAGTTGCTCGGTGGGGAACGAAGAGTACGTGCAAGAATCTCGTTCGT
GTGAGCCCCAAGGAGTGAAAGCGCAACTGGCGACTTGGCGGTCGACACTAGACGAGACTTTCCAGAGCTCTAGGCTGACTCTTCCTGTCCTCTTCCGGAC
GCCCAGCAGACGTCGCAAAGCAGACACCAGCATGTTCTGGACAGTGGAAAGCAAAACGCTTGGTTCAGATGGCTTCAACTGCACCGATTCAAACCAGCCA
ATGAAAAACCGCGAGCTTTGAAATCTTTCGCATCTTTTCCCGCATTTCAGCGACATATGGCGGCAAAAATTCGATTTTCGGCCTGTCAGACTGCCAATCA
GAGACGAAGTCTGTCACATCTCCTAGGGCAGGATAGGATTCCAGTTAGGACCACTTCAACGTCAATTCGTGTATCAATTCCACCCGTTATTTTTGTCATT
GGCCTTCTCGTTGTCATTGGCCTTCTCGCTTGAAACGCTGCGTCTGACGTCGATGAGCCATTGCAAACTGCACAAATGCAGCTGAGCCCACAGGCTCAGG
TACCACAGTACCGCGTCCTTTGACGTCTAGGCGTCGGACCTCATGGCGTCGGAACTTGGCTCCGACAGTTTCTTGCGTCGTTCTCGCTCGTTGCGGATTT
GCTCCTGTACGAACCGTCCAAAGGATTCGGCCAAGTCGTCGATGCGCTTCTCGTGCTCGTGGTTCTGCGCTGATAACTCGCGTTCAAGGCGCAGCACTTG
ACTCTCAAGAGTTGCAATCAAACTCGTCTTTTCCTTACAGATGGTGGCGCTCTCCTCAGCCGCGATCTTAGCGCTGGTAGTCAAAGTCTAGAAACAAGGA
ATGACACTCATTATCTCAGTGGACATGAGCGGGAAAATCCAATTGTAGACGCACCTGAATTCGTTCGTCGAAGGTTGCCTGCATCTGCACGAGTCGAGCA
TCCTGCTCTTCCAGTTTTCGAAGCTGGAGCTGAAGCTTTTCCTCGCACCGAGATCGCTCAGTTACCGCTGCAGCCAGTTGCATCTGTTTCTCCTGAAGCG
CCTTGGACTGTGTCTCTATTGCTGCGTCCATCTCACTCTGCTGTTCATCTTTCGCCTGTTGCAACGACACATTGTCTTGACGGAGTTGGATGATAGTCTC
AAGATGCTTTTCTACCTCTCGTTCGAGATGCTGCCGCGCTTTCTTCACCTCAGCAACTTGAGCTTCAACGGACCCAACCGAACGTTGTATGCGCTCCTGA
ATCTCAGTCTCCCATTGCTGCTTTAGATCACCAATTGTCTTCTCATGGTCTATCTGAGACTGCAATAGCTTGGCTTGCAGTGCTTCACATTTTTCCGATA
GCTCTCGTACATTTCGCTCGTTTGTTTCGAGCTGCATCGAGGTGTAGCTTAGCTGTGTCTGCATGGAGCCTACAACCATATCATGCTGCCGCTGGGCCGC
ACTCAAGCTGCTTTCGTGATCCGACACTAGCTTGGCTTCTTTGCGACCATACTCTTGCTGAGCATCGTGTAGTTGCTTCTGTAGCTTCTCGATATCTTCT
TGTTGCGTCCTGCTCAGCAAGTTGGTAGCGAACTGTTAGCTCAGTAGTAGCTGACCAACAAGCAGTAGCTTACCTTATCGTGAGATTCATTCGGTGCATC
TCGTTGTCAAGCGCATACTTGGCTTCTTCTAGCTGTGAAATCTGCTTGTCTTTCTGCTCTGCTTCCTTGCTTCGTAGAGTCTCCATGTGTCCCATCTTCT
CTCGAATCACTCCATTCTCGCGCTCAAGCGAGGTGCGTGCAGACCGGTACTCTTCAAACTCCAGCTTCCTACGGTTCTCGAGTTCATCAAGCTGCATTCT
TTGCTCATGAACGTCGCGTTTTGCGTCGATCTCGCGTTGTTGGTAGCGATCTCGTTCTTGTTTAGTCATTTCAGAGTCTTTACGAATCTGTTGTAATTGC
ATCTCGAGCTCTTCCGTCTTCTCTGTCTAGCGAAGCACAATCAACATGAGTTACTCCTTCCGAGCAAAATTCACCCTTCATACCTTACCAATTTCTGTCG
TTCTCGTTTGCCAAGATTTAACTCTGTCTCCAGCTCCTCTTTCTCAGCTAGTACTTGCAATAGTAGCTGGTCATCCGGGGAAGTTTTCGGACTTTCGTTG
TTTGAGCCAACCTCATCATCAGGTTGACACGAAGCGTCCACAGCCAATGGCGACGGTTTCTCCATGATAGCACGATTTCTTGCCAGCAATACCTCGATCT
CGTCCACGTGCTTTAAGCTGCAGTTGTTCCCCATGAGTTGCAGCGTCACTAAAGAGTGGTTAGTCTGCAACGCCTCACGAAATGCTAATACTCCAGGATT
CGCAACTTCATTCCAACGCAAATCCAATTGACGCAGTGTGCGGTTGACTCGGAGAGCTTTTGCAAGAGCTTTGGCCCCCTCAGGTCCAATATTGTTGTTG
CGCAAGTCTAGCGTCAGCAACCGCTTATCGACTTCTAGTGCGCCAGCGAGAGCTTCTACTCCCTGGTCCAGTAGACCTACGTTATTCCATTCAAGGCTGA
TGGCCACCACATTGTGTGAGGAGCGCAGCAACGTCGCCAATGCTCGTGCAGCACCAGCTTCAAAACAATTACCACGCAAATCTAATCGAGTTGGGGAGTT
CGCTAGCCGAACCTTCTCCACGATCTCCGCGAACTTGTCATCCCCCAAATACGAATTGCTGTAGTCCAGCACTGTATTAGCCGGTTTGACGATTGAAGCA
CCTTGTTTGGTGTGCACCAGAGCTGCAACGTTTGAGTCCTCATTGAGATACTCTCGCTTCGGCTGGATTGTCATCGTTCAGGATATGAAGTCGTTTCGTA
GATCTTTTACGCCCACTCAAGAAGAATGGGCACATTGTACATGTGCAATAATGCAGTTACTGAGGAAGTAAATGTCTCGCATCTAAGCAACCATTTTTCT
CTGCTGTGCTGAAGCTGTCGTACTCAAACGCTCCTGCACAATCTTGACCTTGGTAGAAGCCTATCTCGAAAAGTTTACTTGGCGTAAAGATTGTATGAAA
GGTTCATGGAGCTGCTAAGTATTATTATGGCTTAGATTGCTCGTTGTAAAAGTTGCTATGTGCTGTCTAACGATTCTATACTGGAAATCTACAACAGACT
TTGCAACCGACCATCATCGTGCCCACTATCGAATAGGT