Description :
From Genome Similarity Track
Location :
Scaffold_619:2606- 7421
Sequence
4815 bases(100 bases per row)
CACGCACGACCTCACCGCTACCCAATCCAAAATCATGCCGCATCAAGCGACACCCCCACACTGCCTCCGCCCAGGGCCCAGTGCCCCGGGCCCAGGGCCC
AGGGCCGAGTGCTTTGACGTTGTAAGCCCGTGGAAGCGTGAAACGACGTCTGGTATTCACTTGCTTTTGCACGCATCCACAAAGGAGATATGAGGTGCTG
GGATGGCCTGTAGGTTGGACACGCATGTACATATGTAAGGACGGAAGCGACGCGGCTAAGAGAGGCAAAAGTTGCGCCGTCGGGGAATCGAACCCCGACC
TCATCCTTGGAAGGGATGAATCCTAACCATTAGACCAACGGTGCACAGCACACCATATACACATAAACACCACAACATTCACACATACTCAGCGCATGCA
ATCACAAACAAACCAAACCAAACCAAACCAAACCAAACAAACCAAACAATCCAAACAAACCAAACAAACCAAACAAACCAACTCACCGCACGACCAACCT
ACCAACCAACCAAACGCCTACACCACACCAACTTTCATGCACGTAAAACGAAACCACAACGTGCAATACAACTACCCACACCTGAGTATGAGTACCACCA
CACCTGAGTATGAGTACCACCCCACGCCACACCCACTGGCCCTTGTCTACCTGTCTGCCTACGTGTCTGTCCCCCCGCCTGCCTGCCAACCTACATACCT
CACTGTTCTCACCGCTCCAATCGCTCCGACGCTTGCCTTACCTCGCCCTGTCCCGTCCAACCCTGCTATACCGAGCACCACTGTGCGCCAGTGTACTATC
GTCCGATGTCCATTTTGAAAGAAACATATATTGATCGACGAGCGGACAGGTTGTCACCGATTCAAGGCCTCCTCCCTTCTTTCCTTCCTTCCTTCCTTCC
TTCCTTCCTCCCTCCCTCCCTCCCTCCCTCCCTCTCTTCCCCTCTTCCCCTCTTCCTTCATTATGGAAGCTCTGTCGACTCTACTCACTCCGTAGTGGTG
ATATTACTGCCCTTGCGGGTATGTGGGCGTAGATGAATAGCTGGAGCTACGTTGTGTCGTTGTTGTTGATTTATGCCAGACTGGCCATAAACCGACGTAC
GTCACTTGCTCCTCACACGAGAGCGGCAGGAAGAGGGGGAGATGCAGTGACTTGCACAACAACCGCCATTTGGTGTATGCATACATGTTCACTTGCATCT
ATGACGCCATATCGAGACGACAACGCGACATGCAAACAACAAGCAAGCAAGCAAACAAACAAGCAAGCAAGCAAACAAACAAGCAAGCAAACAAACAAAC
AAACAAAGAGGCAAGACACTCTTGCTCTTGCTGAACAAGGCTTCGGAGCCAAGTATCCAATGCCGTGGTGGACCGATACCGCATCACTCGCGTTTCGCCT
CGACTCGATGTCAGATGCTGCTGTGATTGCGTTTGATGATTGTCCGGGTTATCGGAGCTTGGAGGAGGACAGTAGTAGACCTCCGAGTCTCTTGGAGGCC
TGGTAATAAGCCTCAGAAGAAATGACAAAAGGTGCACCAAGCAACAAAACACCCTGAGCTCAGCCAACGACAGAGAGCAGCACACACGCCAGTCGGTTCG
TGAGGCGATTAGTACGTGGCTCGCCTGCGGTAGCCATACGCTCACGCAAGACGTAAAACGCAAGACGTAAAACGCAAGACGCAAGACGCAAAACACAACA
CGCAAAACGCGAGGCATAAGGAAGGCGTGCGCCGTCGGGGAATCGAACCCCGACCTCGTCCGTGGGAGGGACGAATCCTAACCATTAGACCAACGGCGCG
CCAGAACAACCTCATGCTACCCCAAAACGAACACCCACAGAACCACAACCCTAGACAAATACACAGCAAAAACATACACGCACGACCTCACCGCTACCCA
ATCCAAAATCATGCCGCATCAAGCGACACCCCCACACTGCCTCCGCCCAGGGCCCAGTGCCCCGGGCCCAGGGCCCAGGGCCGAGTGCTTTGACGTTGTA
AGCCCGTGGAAGCGTGAAACGACGTCTGGTATTCACTTGCTTTTGCACGCATCCACAAAGGAGATATGAGGTGCTGGGATGGCCTGTAGGTTGGACACGC
ATGTACATATGTAAGGACGCGTAGGTAAGCGCTCCAAACAAGGTACAAGATGGGAAGCGACGCGGCTAAGAGAGGCAAAAGTTGCGCCGTCGGGGAATCG
AACCCCGACCTCATCCTTGGAAGGGATGAATCCTAACCATTAGACCAACGGTGCACAGCACACCATATACACATAAACACCACAACATTCACACATACTC
AGCGCATGCAATCACAAACAAACCAAACCAAACCAAACAAACCAAACAATCCAAACAAACCAAACAAACCAACTCACCGCACGACCAACCAACCAACCAA
ACGCCTACACCACACCAACTTTCATGCACGTAAAACGAAACCACAACGTGCAATACAACTACCCACACCTGAGTATGAGTACCACCACACCTGAGTATGA
GTACCACCCCACGCCACACCCACTGGCCCTTGTCTACCTGTCTGCCTACGTGTCTGTCCACCCGCCTGCCTGCCAACCTACATACCTCACTGTTCTCACC
GCTCCAATCGCTCCGACGCTTGCCTTGCCTCGCCCTGTCCCGTCCAACCCTGCTATACCGAGCACCACTGTGCGCCAGTGTACTATCGTCCGATGTCCAT
TTTGAAAGAAACATATATTGATCGACGAGCGGACAGGTTGTCACCGATACAAGGCCTCCTCCCTTCTTTCCTTCCTTCCTTCCTTCCTCCCTCCCTCTCT
CTCTCCCTCCCTCTCTTCCTTCATTATGGAAGCTCTGTCGACTCTACTCACTCCGTAGTGGTGATATTACTGCCCTTGTGGGTATGTGGGCGTAGATGAA
TAGCTGGAGCTACGTTGTGTTGTTGTTGTTGATTTATGCCAGACTGGCCATAAACCGACGTACGTCACTTGCTCCTCACACGAGAGCGGCAGGAAGAGGG
GGAGATGCAGTGACTTGCACAACAACCGCCATTTGGTATATGCATACATGTTCACTTCCATCTATGACGCCATATCGAGACGACAACGCGACATGCAAAC
AACAGGCAAGCAAGCAAACAAACAAGCAAGCAAGCAAACAAACAAACAAACAAACAAACAAACAAACAAAGAGGCAAGACACTCTTGCTCTTGCTGAACA
AGGCTTCGGAGCCAAGTATCCAATGCCGTGGTGGACCGATACCGCATCACTCGCGTTTCGCCTCGACTCGATGTCAGATGCTGCTGTGATTGCGTTTGAT
GATTGTCCGGGTTATCGGAGCTTGGAGGAGGACAGTAGTAGACCTCCGAGTCTCTTGGAGGCCTGGTAATAAGCCTCAGAAGAAATGACAAAAGGTGCAC
CAAGCAACAAAACACCCTGAGCTCAGCCAACGACAGAGAGCAGCACACACGCCAGTCGGTTCGTGAGGCGATTAGTACGTGGCTCGCCTGCGGTAGCCAT
ACGCTCACGCAAGACGTAAAACGCAAGACGCAAGACGCAAAACACAACACGCAAAACGCGAGGCATAAGGAAGGCGTGCGCCGTCGGGGAATCGAACCCC
GACCTCATCCTTGGAAGGGACGAATCCTAACCATTAGACCAACGGTGCACAGCACGCCATATACACATAAACATCACAACATTCACACATACTCAGCGCA
TGCAATCACAAACAAACCAAACCAAACCAAACCAAACCAAACAAACCAAACAAACCAACTCACCGCACGACCAACCAACCAACCAAACGCCTACACCACA
CCAACTTTCATGCACGTAAAACGAAACCACAACGTGCAATACAACTACCCACACCTGAGTACCACCACACCTGAGTATGAGTACCACCACACCTGAGTAT
GAGTACCACCCCACGCCACACCCACTGGCCCTTGTCTACCTGTCTGCCTACGTGTCTGTCCACCCGCCTGCCTGCCAACCTACATACCTCACTGTTCTCA
CCGCTCCAATCGCTCCGACGCTTGCCTTACCTCGCCCTGTCCCGTCCAACCCTGCTATACCGAGCACCACTGTGCGCCAGTGTACTATCGTCCGATGTCC
ATTTTGAAAGAAACATATATTGATCGACGAGCGGACAGGTTGTCACCGATTCAAGGCCTCCTCCCTTCTTTCCTTCCTTCCTTCCTTCCTTCCTTCCTCC
CTCCCTCCCTCCCTCCCTCCCTCTCTTCCCCTCTTCCCCTCTTCCTTCATTATGGAAGCTCTGTCGACTCTACTCACTCCGTAGTGGTGATATTACTGCC
CTTGCGGGTATGTGGGCGTAGATGAATAGCTGGAGCTACGTTGTGTCGTTGTTGTTGATTTATGCCAGACTGGCCATAAACCGACGTACGTCACTTGCTC
CTCACACGAGAGCGGCAGGAAGAGGGGGAGATGCAGTGACTTGCACAACAACCGCCATTTGGTGTATGCATACATGTTCACTTCCATCTATGACGCCATA
TCGAGACGACAACGCGACATGCAAACAAACAAACAAGCAAACAAACAAGCAAACAAACAAACAAACAAACAAAGAGGCAAGACACTCTTGCTCTTGCTGA
ACAAGGCTTCGGAGCCAAGTATCCAATGCCGTGGTGGACCGATACCGCATCACTCGCGTTTCGCCTCGACTCGATGTCAGATGCTGCTGTGATTGCGTTT
GATGATTGTCCGGGTTATCGGAGCTTGGAGGAGGACAGTAGTAGACCTCCGAGTCTCTTGGAGGCCTGGTAATAAGCCTCAGAAGAAATGACAAAAGGTG
CACCAAGCAACAAAA