Description :
From Genome Similarity Track
Location :
Scaffold_184:26059- 27472
Transcript NameFunction/comments
Phyke_g6071hypothetical protein PHYSODRAFT_319282
Phyke_g6072hypothetical protein

Sequence
1413 bases(100 bases per row)
GCCTCTCGAGGGCTTCAAGGCGCTCGAGGGCATGCGTGGCACGCAGAAGTTCAACATCCATAAGGCCTttggcaacaacagcgcACTCCCGTCTGCACAT
ACTTGGTGAGTTGGTGTATCCTTGTAGCTTTATGACCTGAGTGATTAGACTAACTTGAATGTGTATCGTGTTGTGTTGTACAGTTTCAATCAGCTCGACC
TACCTGAATACGAGAATGAGGAGAAGTTAAAGCAGTGCCTACTTCTTGCGATTCGCGAAGGCTCGGAGGGCTTTGGCTTTGGATAGGTAAATGACAATGA
TGCACAAAGTCTTGGAAAGCTTTCTACTTCTCAGAGTACTTTACGCGACAGAAACGTTCCAAGCAGTAAAATGAATGAATACATGGAATTCATGTCTGCA
GCATAGCGAATGTCTACCGTGATTATGTGCAGCATGCTCTCTTCGCGTGCTTCTACATCTATTTGCGCCTCTTGTATTTCGCCTTGGACTTGAAGGAGGT
CGAGCTCTTTTTCGCGTGCTTCTTGTAGTCCGTAatcttctccttgaactcGAAGGAGTTgttgccagcaccaccttcgcgCTGCTTCCTGGACTTTGGT
GCCGGGGCACCGTCGCGGGTCATATCAATGTCGAACGCGTTCGAACCATGGCTGCTGCGCGCAGAGCGAGCCTTCTCTCGCTTCAGGCGCTTGCGCTCAT
GCATCTCCGAGATAGACTCCTCTTCACGCGACCGCGTGGTGTCCTGTTGCACTTTCTTAGCACGCTTAGCGTCACCAGCAACATTCATGGATGTGAACAC
GCCGTTCTTGGCCTTTTTGCTGCTACCTTCGCCGTCTTCATTATCTTCAGCGTCGGCCAGCATGCGTTGCTCGCGTTCACGGATTTCGAAGAGACGGCGC
TTCTTGTGACTCATGAGCTTGAGCTTTTTCGCGCGCGACATCGTGCtagcagccttctcctcctcctcccTGACAGCGTCTTCCTTAGCACGGCGGCTCT
CTTCGGCATGCTCGTTGACTGacttcttttccttctccgACATAAACCACGTGCGTGCAGGACGCGAGTTAATCTCGTCACGATGCTTAAGCATGTTAGT
GGCCCGCGTGGCCTCTTTTTCAGCTTCACGCATACGCTTCTCGAGGGTTTCTTCGTGCATTACGAGTTTTACATCCTCCTGCATGCTCTCAATGCGAGCC
TTCCACTGCGCAATCACAGGGTCTGGCACTGCGCGAGATTTAACGAAGCCGTTGCAGTGACGAGACACCTGCTTCATAACCAAACGACGAGACTCACTTG
TCAACGTCACAGCACGACCATTACGACCGGCACGGGCCGTACGACCGACACGGTGGACATAGGTCGTGATGTCCTTGGGCATTTCGTAATTGATAACGGC
GTGCACCCCACGC