Description :
From Genome Similarity Track
Location :
Scaffold_200:26058- 27098
Transcript NameFunction/comments
Phyta_totarag5474hypothetical protein

Sequence
1040 bases(100 bases per row)
TGTCTCGCTAGGTTACGATACCTTTCAAGACCATATTTGCTCGCATGATCCAAGCACTTCCCACATTCGTGTCAGGGAAAACCAAGTCAAGTGTCGAATG
TGCACCGATGGATCTCAGTCTCACTCAACAAGCGCTGACAGAGAACTACTACGATTCGTTGTCCATGAGATCAAAACTAGTGAATTTCCCCAGCGtttca
agtacgacaggCTGGACACTCTAATGCTCTGGAAAATCGATGCCGTGGTGATTCAGTAAATTGAATGGTGACGATGAAAACAAGTTTTGAAACCATTTTA
TGGTAGTGACGATATCTACACGGGAGGGCCGCCAACCGTACCTCTTCCGGAGAAGGTGCGCACTAATGTGCTACGAATACCACCAGCGAGACTTGAAACA
CCCCACGACCGCGCCGAAGTTTCACTCCCTAAGTCAGGTACAGCGTTTGTTGACGAAGCGGCTTGCAACCACGAGCTTAACGTAGTTTCCAGCCGCTTAA
ATCCACCCAACGTCATGAGGTCCAAACGGTTGTTTGTGGCATATGCGTTCAAGGCTGCGTTATCGCTTGTTTCCGTGTCCGTGCTCGAATcagtgttgtt
gctgctgctactcaGAGATCTCATCAGCGTGTTGTACTCGATTTCAAGCTTTAAGCTCCACGTGCGCAGATGCATGACGCCTGCTTCAAATGGAGCCGCT
TGCAGCTCATTTTGTTTCCCGTTACTCTGAGcaaagttgctgcaatggAAATAATGCACATGGAGTAGACAAATGATGTTAGGGAGACACAAGGAACCGA
GACCTCAAAGACGGAAACGCACTCAATAGTAACCGCGATACACTGCTCAAGAAGTCGTGGGAACAAATCGATGTAAGTTGCTGAAGGTTCTGCCAGCATG
CGTTGCCCCATCGgttcaagaaggtgctgcacaaGACGCTCGATAAACTCTCTCTGCAAATATTGACAACGATAATAGCAGTGAACTTAGTGCAGGTACT
CGAGGAACATCAATGGTTGAGGTACCCACCGCAGAAATCC