Description :
From Genome Similarity Track
Location :
Scaffold_452:2605- 3825
Sequence
1220 bases(100 bases per row)
tacaataatcgccctctattccggtactggtataaataatatcctaaactatcgatacaatcgacggggattctggcgcgaatcgatcagctccgaccat
ttgaagaacaacacagtgatcataggcttccgatcataattcaaatcataattcacattggtttatacccatggggagctggatgaagatacagcagaag
cgaggcctcatccagaagacagcagattgtcctgatatgacgcaagaagagctggctgcgtgggcaaaagcgacgtacaggctgaggcgagcgtctgcaa
caaactactgtctctgacaacctaaaaaagcagcgaagatcatgcgcgacacctacggatacgacatgcggtggaaacacttacgcatgacgtcgccagc
gctggagaagctcttattagagtggattctgaaagtagaagctaaaggtgtatgtttctcacgagacttaattaagctaaaagctcgtgatattcagaaa
gacctgtgtgatgcgtgagatatgactttttcggacggatggttggccccattgagcggaggcattgcttgcggagccggaaactccctggtgaagctgg
cactgctgatcccgtcgaagtagcgctcgaccgtcagcgactacaagatttggtctacttttacggccctaaagatatctacaacatggatgaaaccgga
ctctgctatggctccctctcgctccacttccgtcaggggcgctcgcggtggcaagaaaaggaagactcgtattacacttgctctcactgcgcacacagat
ataaccgatacgttgccggtgctgtatctgggtcacgcaaagaagccgcactgcttcaagaagcacacagcggaggagatgaggttcagctatcgctcta
ataaaaaggcatggatgacgggcgttattttcaaggaatgactgcttaatctggataaggatatacttgcatgtgggcgccttattctattactactaga
caacgcttttctcacaaactgggagatgttaaatgcaccaacgaccgtgtggaatttcttctccccaacactgcagcgttcctacaacctatggacgctg
ccatcatcgcgtcattcaaaacggcgtaccgtagaaacaattgcaatgagtgtacgacaagatcaaggacggtgttgagattgacaggaaggcgtatgaa
gtggaccagctgcaggcaat