Description :
From Genome Similarity Track
Location :
scaffold_75:26047- 27765
Sequence
1718 bases(100 bases per row)
CAGTCAATGGCGAAGGGCTTTTCGAAGCACCTTGGGGTGGAAGCTTCTGCTGTTCCCGTCCAACAGAGATGTTGCTAGAAAATGGAGAGACGACCAGGAG
AACCTGTTGCTACTGTGGAGAATACACACTGCGATAGTGTTTCACGCAACGTGGCGACTGTGCAATGACATTTGGATACTTTGGCGAAACACAAGCGGTG
ACGCCAAATATTGCTAACATGCAGGCTTCATTTCGAAGCACTGCCAATTCTTGTTTCGACATTCATCTGATTAGAATGTTGACGGCGGAGCGTGCTTACG
CGCTTGGGATTCGAGTCAGAACAGATCGAACTACTTCCTAACCTCCCACGACAACGAATATGGACTCCGCGATGCTAGACATAAAACACTGGTAATAGCA
TAGGTCTGCCAGATCAGCTAAATTTTTACCAACATAAGTATCAGAATCAGATTTGAAATCTGAGATTTCAATCGGAAGGATCTCAAAAGTTTTTGGATGA
ACTCAATGCTGCAAGTTTCGGTGCTCGCGTGGGTACTGTGTCATTGCTACTTGAGCGCGGTAGGTACGGCGTCTCCTGTAGATACAGAGGATCGTCTTGA
TATCGCCAATGGAGACCCGATCACTAGTATTAGCCTGATGTATCCAGCCGATGGAGCACTGGAGGCCGTTCCAATTGCGTTCCGAACAGAAATCGGTGTG
AAGTCGGTTGAGGACTACAAACGGTACTACGGAGATAAATTGCTATGTGTCGAGCTCGGTGGAGAGCTGAAAACGAAGACGTGCAGTCCCATGATGGACC
CCAACATTGTGTTCGACGTACTGCCAATTGGAGACTACATAGCACAGGCGTTTATCACGGATAAAGAGAGAGCGCTACTGTATCATCGAAGTTCCGTATC
GACTTTCTCCGTCGTGAGCGAGGAAGTATTAGCAGCACACGTTGAATCGCTGAAGTTGCCTGAGGAGCAGAGTCTGGTCGAGTGGGCAATGCTACAAGAA
GAGCTGCAGCTACTAGAGGACCAAGTGAACGGAACGATTTCGCGGAATGATACTAATATATTTCTCGTTATTGGGGTGAAAACGGCATTGGCGGACGGCT
TTGAGCTTCGACAAGCCATTCGACAGACATGGGCGAGCACTGACACTCTTCCACTTGATGTGAAAGTGCTCTTTATCGGTTGTGTGCCAAAGTTTTGGGA
TTCTCACGAGCAAGAGCAACTTCGAAGAGCCATCAACTTGGAGAAACAAACGTACAACGATCTACTGACTGAGGAATTGCACTGTGAAGACTCGTTCGAA
GATCTGCCAAACAAGGTGAAAGAATTCCTACGCTTCACCGCAGACAGATTCCCTCTTACACCTTTTGTGATGATTGTGGACAATGACATTTACTTGAGAG
CTGATCTGTTGATCGAAGAGTTACGAAAGGAAGATAGCATTCAGCAGCACTTTTACATGGGGCAAGTCTGGGATGAAATCCTGGGTAGAAGTCAAATTCC
TCTACGCGACACCTCAGAGCGCTACTACATCTCGGAAGAAGACTACCCGTTGCACTCCTACCCTCCGTTCGCGTTTGGCCCACACTATTTGCTTTCGATG
GACTGCGTACGCTTTATTGCCAAAAACAGTGGTCGATTGCGCGGTTTAGGTGCCATGGACGATGTCAGTGTTGCGCTTTGGCTACTACCAATACATGTGC
ATGTAGAGCACACGCATT