Description :
From Genome Similarity Track
Location :
Scaffold_105:26045- 29859
Sequence
3814 bases(100 bases per row)
TCGACTTCATACTGGTTCGTACTTGTGTCTGGCTCCCAGCTGTCTTCAGGCAGTAATTCTTCGTCAAAGTCAAATCGCTGAGTCTCTTCAAGGTGGGCGA
TTAGCCTCGTCTTTGGTCTTCCGCCGAGTTCGGTGACTGCCTTCAGACGTGATACATGGACCACTGGGTAGAACCTATATCCACTCTTGTCGGGTAACTC
CAATTCATAGGCGAATTCTTCCACCTTCTTCTTCACCCTGAATGGCCCATGCCATCGGTGGGCTAACTTCGTGGTCAGGCCCGACTTGACTCGCTCCATA
AACAACCAGACTTGATCTCCTTCTTTGAACAAGGATTTGGTGGATTCATCGCCTGGTTCTGCAACTCCATCTTCGTCATCTGCTGTGTTGGGGATGGATC
TTTTCTCCTTCTTGCTCAACGCTTCGTTGTGCTCTCGAGCTCGTCGTGCTTTCTCTCGCACTTGGAACTCAGCTGCTAATCGAAGTGCCACTTCTCGTTG
TCTGTTCGCTTCTCGGCGCCACTCGACTGCGTCCGCCGAGTTGACTGGGCGTCCCTTTCCACGTTGTATTGAACTCGTCATAGCCTTGAGTGTAGACTTG
GCGTCCCAACTATGTACCATATAGAAAGGGGTTTCTTGCCGAGTCGAATCTCTTGAGTTGTTGATAGTGTGTACCATCTTCTCGGCGATGTCATCCCAGT
CGGCTTGAAGTGGGTCTTCCACGTAGACCCGTATAGTCTGAATCATTGTCTTGACTGACCTCTCTTGTTGACCGTTGGCTTGTGGTCGGTAACTCAGCGT
AGCTCTTGATCTCGACTGCATCATCTCGGAGAACGTTTGGAATACTTCACTCATAAACCTTAGATCTCGGTCGTGCCGTATCAGAGACGGAGCCCCGAAC
TGCCTGAAGACGCATTCCTCAAATACCTTGGCCACTTCGAGCGCCCCGGTGTCATTCATAGCCTTAGCGATAACGAATCCCGTGAAGTGGTCCTGGAACA
GCAGCAGTGCAGTATTGCCCCGCTGAGTTCGAGGAAGGGGAATCACGAAATCCATTGACACGACTTGGAATGGATGGTCTCACACCACATTTCCCGGTGA
GTAACCTCTTAACTGTGGCTTGCTCTTACTGGTATTGCAGTCCTCGCAGGCCCTAACATGTTTCACCACGTCGGCGTAAAGACCAATCCAGTTGTAGTCG
GCTTTGACTCGGTGATACGTTCTGACAATGCCTTGATGTCCTCCTTCGATCGAGTTGTGACAGTTATGAAGTATTTCGTCGACCATAGTTGACGGAATCA
CCAATCTCAATGAGAGGTTCGGTTCGCCGAGTTCGCCCAGTCGGCGAGCTTCATCTCGGCGGTATAACAGGCCGTCTTCGCTGAGTACAAAGACTTCTGC
GACTTTGCCGGCATTCTGAGCTCGACGGTGTGTAAGGTCCTCAAATTCGCCTCTCAGGTACGCTTTCAGATCGGCCCACCTGAGTTCTTCATCTTGTGCC
TTCGCGATTCGTCGTCTCCGCTCAGTCTGTACTGTCACTGGATCAATGTCGTTGGCATTCCTAGCTGTCTGGCTGACTCCATCTGTGACCCTGTTTCGAC
ATTCGGGGTCGTGTGGTTAGTCCGCCGAGTCGACGCCCTGCTGACTTGTTCGAAATCATCTCCACTGCTTTCAAACGCAGATTCTCCAGGATTTGTTGAT
ATGGCTTCGTGATCCTGACTTCCCCCATTTGCTCTAGCCGAGTCTTCATCCAGCTCGTCCTCAAAATGAACTCGGCGTACTCGACTACGAGTGACTGCCG
TGACAATCGGGGTTTCCGCTGGATTGTCTGTGGCGTACAGTTCTTCGGCTACTCGATTAATCATTCTCAGTTCTGCTTTCCTACCCGTCCCGAGAATTAC
TCGTCCAGCTTTAGCTTCCAGTGCTTCTGTAGCGAGGGAATCAGCCGCTGCGTTATAGTGTCGCGCTATGTGTCGATACCGGACCGAGTTGAGTTGTTTC
GTGAGATCCTTGTGTCGAGCTAGCTCCACTTGCAACGTTTCTTTCTTGCATGCTATCACCCCCATGGATTGCTGGATTGCAAGCCGGGAGTCACAAACGA
TAATCAGATCGGTTATCCCTCGGTCAATCGCCGCCAAGACTCCATTGTTCATGCCGGTGTACTCGGCGATGTTGACTGTGGTGGACGACAGGTACGCACT
CGCAGCAATCTCAATGTCCCAATTCGGAAGGCACCACAGTATCCACGAACAACTGCCATACCCGCCGTATTTAGCCGTCTTCGCTGAGCCATCAAATGAC
AGCACGCATCCTGCAAAGTCAGCTGGTATTCGGGCATATAGCAGCGCTGGGTCCATTCGAACTGTCGCCGAGTTCTTGGAGGGAGGCGCCAGGTGCTTCA
AGGAATCGTCGAGTCCGATAAACGGGGTTATCGACGCCTGGAGCAACTGGGCGAAGTCTACATCTCGCTCACGTACTCGCTTCACCACCTTCAAATCGTA
GGGCGACAACATAACTGCGAAACTGACTGCGCGGCCGTACAGCGACTTAGACTTAAACACCCACTCCAACGTGGAGAAACGGGTGTAGACGTGTAGCGTC
TTTCCCGCCAAGAGAGTGTAGCACACTTTCAGCAATTGTAACAGCGCGACTACTTATTTCTCAGCGGGATGATAGCCGAGTTCATTCTCCTTTAGTACGC
GTCCGCAGAAGCGAACTGGGTGCAGCTTGTCGTCGTGCGGTTGCATCAATGTACTGCTTAGTTCCCACTCATTGGCGTACAACATTATGTGTACTTCTTT
CGCCGAGTCGAAATGACGCAGAATTGGAGCTTCTGCTACCCGTCTGTGAGCTCGCGAATGATGCTTTGCTGACGCTAAGTCACCCCCAGGGCCAAAGTCC
GTATCCTTTAGCTGATAGAGTACTGCACCGTAAACAGCCAAGTTCTGGATGAATCGGCCGTAATAGTTCAGGGCACCGAGGAAAGCTTGCATCCCTTTCT
TTGATTTCGGGAAGGCGAGCTCAGCGATCGCGGTTATCTTCTTCGCGTCAGCGCGTATGCCACTCGGCGTAATCTCGTGAGATAGGAAATCAACCTTGGG
TTGGCCAAAGATACTCTTGGTAAAGCTGATGCTAATTCGACATTCTGTGAACCGGGCTAGTAATCGGTCGAGTGTCTCCAAGCAGGCGTCGAACGTCTCC
CCTCCAAAACAGATATCATCGACAAACGACCTCCGCTTGAACACCGGAATTAAGGAAGACTGGTCTGGCTCTCCATTAGCAAACATGTCGCCGTCCGGTC
CGTTGACCAGGTCTTGGACCGGATCGCAGTCAGCTTGTGATTGGTGGTCAGCTTCAAACTTCGTCAGCTGACTCTGCGTTGAATCGCTGACTCCGCCGAG
CTCAACTCGCCGAGTTCCCGACTCGGCTTCAGCAACAGCCGTTCGTTCAGCAAACAACTGCCATCCTCCCTTTGGTTGAACATATCCCCATAGAGCGTTG
TCAATCAGTCGTTGGTAGATCATAGGCGCATTCTTCAATCTAAACGGCATTCGTAACCATTCAAAGTGTCCAAGCGCACAGACGAACGCTGAGATCTGCC
GAGCTCGGCGTGTCATCAAGACTGCCCAGAACCCACTCGCAGCATCGAGCGAGCAAAACCACAAGTAGCTCTTCAATTCGGTAAGCAGGTCATCAACCAG
TGGCATAGCGTATTTTATTGGTGTCGTAACCGCATTAACCAGTTTATAGTCAATGCATAGCCGAAAATCCACACCATTTTTCTTGAGCACTATCACCACT
GGCGAGGCCCAAGG