Description :
From Genome Similarity Track
Location :
Scaffold_296:26044- 27184
Transcript NameFunction/comments
Phyag_g4424Avr4-associated TDF-like protein

Sequence
1140 bases(100 bases per row)
TTACTGACCCGGGTGCACGCCAAGGAATCCCGGAGTCGGCTCGCCCTGCACCTCGCCAAAGTACAGCGTGAACGTCtgcttccactgctccaccaccgcg
cGGTCCGCCATGAACTTGGGGAACTCATCGACGTTCGCCTTGCATATCTCCCACGGGTGGCTCGATCCGCTGTTCGGGGTCAAGTCCACGCGCACGTTCT
CGTTCATGACCGACTTCTGCGCGTCCTCCGAGATGGCCCAGTTCATAAAGAGCTTGGCGGCCGCTGGGTGCTTGGCCTTGTTCAGGATGGCGATGCGCTG
ACCCCACGCCAGATACTCATTGCCACCGTCCGTCACGAACGTGACGTTGGGTGTGCCCAACGAGTACGTGCCAACACCGATGACCTTGTCTTTGGCTGTC
ACGAGATCGCTGGGCGTGTTGGATCCGCGGCGGAACGTGACGTTCTGGTTGGCAAAGTCCTCGACCCAGCTCCAGCCGTACTTCTCCACGTAGCGTTTGT
ACAGGAAgagcacggcgtcgtcgtcgttcggGTAGGACGAGACGATCTTGCCGGCCCACTGCGGGTCCACGAGATCGGCTGGCGACTTGGGTGCCGGGAG
ACCGTCAAGTGCTGTCTCGTCATACaggaagctgaaggtgaacATCATATAGGCCATGTATGCGCCACGCTGGTCCCGGAAGCCGTCGTAGACCTGCGAG
AAGTTGGCAGGTTTGTACTCGAGCAATTTGCCCTCCTGTGCCCAACGAGGGAAGTcctgcagtgtctgcagcgcAACGAGGTCTGGCACGAGCGTGTCGG
TCTGGAGTTGATTGTCGATGCGCACGTCATGGTACTTGCTGTAGTCGACGATGAGCGTGAAGTTGATTTCCGGGAAGGCCTTGCTGAAGGCGACATGcgt
tgtttgttgctgcgaCGCGAAGTCTCCGCCGTGATACATGACGAGGTTGCCTCCTTCggcgatggcgtcggcgTAGAGCTCGTCGAGGGACTTGGTCTCT
TCCTGGACAGCGAAAGTGGTGGAAGCAAGGAGCGCAAAACAGGCAGCGGCGAGCGGCGTGAAAAGATTCATGGTGAATACGGTTGGCTAGTTGGTCTTCA
AATTGAGGTGGTTGGTCGCAGGccaattgaagaatgagga