Description :
From Genome Similarity Track
Location :
Scaffold_93:26029- 44551
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_93-snap-gene-0.10Protocadherin Fat

Sequence
18522 bases(100 bases per row)
ACGCGAGAGTGGAGTTTGCGTCTTCGTCTGTCGCGGTCAGGAATCCGATCAATGTGCTTTTCGCTGCGTTCTCGCTGATAGAGAATGTGTAAAGTGGCTT
GAGAAACACTGGCGGTTCGTTCACATCAACAACGTCCACATGGACGATGAGAAGGCTTTCGGCCGCAACCTCATTGTCCGTGTACGCGAGTGCGCTCAAT
AGCACGATCTTCAGTTCACACGCGCTACTCTTCTCGAAATTAAAAGCGCCTTCTTCCAAAATCAGTTGGCCGCAAAGATCGACGGACAACGACAGACTGG
CCCCACATGAGCTGTCTATTACTCCAAACTGGATATCACACGTGTCTGCCAAAGGGTTAGCGTCCTGTTCATCCACGACAAAGACGCCCAGTGGAGTTCC
TATTAGCCCTTTGACGGCAAGGTTCTCTCTCACGGTGAACTGCACAGATACCTTCGTGAAGTATGGTGGCTCGTACACGTCTTCCAGTATAATGATCAGC
TTCATCGAGGCCGTGAGGTCCGCTTTGTCAGCGACACAGACGTCAACCCAGAACGTAGGGCTGTGCTCGTAGTCCAAAGCAGATGCATTCAGCACGAGCA
GCTGTCCAACGTTGCTTCCGTGGGAATTCTGAACCAGAAACGTGTTCGGCTGGCTCTGTCCGCAGTTCCAGTACGCCAGCAGCTCGTTCGCGTCGAAGTC
TGTCGCGTGGAAAGAAGTCACAACTGTCCCTGCTGCCGCGTTCTCAACTAGAGGAATCACTGACAGCCCGTCGCTAAACACTGGCACTTCGTTCACATCC
ATCGCGTAAACGAACCCAATCGTGCTCGCGTTCAGTTCTCCATCGGAAACTTGAACCGTGAGCGAGAAGAAGCGTCGCGAGGGCGTCTCATAGTCCAAAC
TACAACCAACCGCCAGCGAAAGCGCCCCCGACGAGCGGTTCACGACGAAGCAGTCGCTTTCGCCGACGTTTGTCTGCACGATCGAGAACGTCAGAATGGT
GTTGTTGTCTGGGTCTAACGCGAGAATCGGGTTTCCGATCAAAGATCCTGGAACTATGTCCTCTGGGAGACTCAAGTTGAAGCTCTGAATCACTGGAGAC
TCATTTACATCCATGACTAGCACGCTCAGCTGGCCATTGGCTATGAGCCCGTCATGATCTCTGACAGTGATGCGCAGCTGGTAGCCTGTCGTCTTCTCGT
AGTTCAGCCGCTTTATCAGCGAAACTTGGCCCGAGGAAGCATCAATCGCGAACAGCCCTTCCTCATTTCCGCCTTTGAGCGCGTACAGGAAATTCTTGTG
TTTCAGGATTTCTGGGTCTGATGTGAGGTTGAGAAAGGGAACCCCCACTGGCGATCCAGTCGCAAGGTCTTCTCTAAGAGCCACTGACTGGTCCACAAGA
GACGGCGCTTCGTTCACGTCATTCACACTGATCAATACTTCAGCGATCGCGAACAACCCAGCGCTATCTTGGACCTTGACAACCACTGTGTACTGGGCAA
TCGTCTCAAAATCGAGAGACTCCATCTGCTGAAATAGCACACCCGTAAACGCGCCAATCCCAAAAGTCTTCGCTGCCTGTCCGCCTTGAGACCGCGAGCG
CTCTTCCACGAGACTAAAGGATACCGTGTCTCCATCCGGATCCACGGCAGTCACTGCCGGCAGAATGCGCGTCATGCTTGGCAGATTCTCATCAATACTG
ACATGCATGGGAGAAACCTGTGGTGGTTCATTCACATTGTTTACCACCACTCGAATGTTCTGCTGACTGCTAAGGCTTCCAAACGAGTCGGTGGCCACAA
TCAGCAGCGCGTACTCAGCCTTCGCTTCGTAGTTGAGCTCAGCGCTCATAAGCGTCACAGCGTTGTCGACTACATCGAAGACACTAGGTAATCCGACGAG
GCTGATAGTGACTGCATCGGGGCTCCCATCACTCAAGGAGTCTGGATCAAAGGTGTTCATGGAACCTAGGGCTCTCGTGCCGACGTTCGAGTTCTCGTCG
ATGTAGAACACGGTTGGGCTTATCTGTGGTCGTTCGTTCACGTCTCGGGTGTAAATCTCAAATTTTTGCCACGGGGACGCCAGCCCACCAGCATCTGTGG
CCCGCACCAAGAGCACGCACACATGCTCGAGTTCATAGTCGACACGTCTTGAATCACTTACCAGCACTTGGCCCTGGCTATCGACACTGAACGGGCAGGA
AGCGCTTGCATTGTGTTTTGAGACAAAGGGGCTTGTATAGCTCCATGTATGTGTCTTCCATGTAACATTGGAGCTGCTGGCGTCTTCATCGTCGACCCGA
AGAGTACAAACCACCTTGTTCACAGAGTTTGAGAGCTGAAGAGCATCCAAATCGTACGGAATCTCATTAATCTCACACGTGTGCGGCGAGATTGTCGTTG
GTGCATCGTTCGCGTCGAGGACCTTGACGGTGACGGCTCCGCAGCCTTGCAGGGGAGGTGTGCCTCTGTCCACCACGCATATTGTGACGGTCACAATTTG
AAGCAGCTCAAAGTTAAGCACTGTAGTGTTCACGACCTTCAGGACACCTGAGCTGAAGTCCACTGCTACGCCTGCCTCACCGGGTTCATCGGACGTGAGC
AGCTGAAAGTCGTACATTCCGTTTCTGAGTGCTGATGAATCTGGATCTGTGGCGTCAATCCGGCACACGACTGTGTCCACTGGCGAGTTCTCGGAAACAT
AGCACGTCTGATCTGGAACACTCGGTGGCTCGTTGATGTCAATGACAACGATTGTCACAATTGAGAGCGTTAATGCGCCTGCGATATCTGAGACTGAGAC
CGTCAGGGCGTAGCTGCTGCACGTCTCATAATCGAGTAAGTCCACAATCGCACTCAGTTGTCCGCTCGTTCCATCGACTGAAAAGATTTCGTCTGGGAAG
TTTCCGTCGAGTATTTGAAATCGTGGCGCATCCCCAGCGTCCGGGTCACTGAAAGGAACGACTCCGCCTTCCAGCAGCACTCTCGAAACTGACGATACAA
CAAACAACAGCACGGTTTAGTTAACCAGAGAGTGCGCCAAGGAAATAATTCAGATAGACAGTGTTTGGTTACCTTGCGTTACCTTGAGCTCCAGCGTCGG
AGCCTTTGCGGGGCTCGCTTCAAACGAGCTCACTTCGCCAACCCCACCACCAGTGATCAGAAATCTCAACGTTCTCACACTCGACATGTTTACGAATGAG
GCTTGAAGAAGAGACGCCAAGTTAGGCGACCACAGTGTCTCCCCTTTCGTTTCATCTGGCAGAGTCCACTGGATGAAGTTGGAGGATCCAAATTTGCTGA
GGTCCCTGCCACTGCCAACGTTTGTCCACGAGGCGTTGGAGATGTTGAAAATGCGGATCTGGAGGGCCAACGGGCCGACTTTCGCGGACGGGACCTACAC
ATGAACATTTGTCCCAGTGAGCACATTTTGGTTAGCGTACTCATAATAGGACATACAAAAGTGGCACGTACTTACGTTGAAGCGAATCCGAGCTTGCGAC
AGCTTCATCGTGTCTGGAAGGCTGATGCTGTCGAACTTGAGCACCACACCAATATCCGCTTTCAAGTACGTGTCGTAGCCCATGCGCAGCGACTTTCTCG
ATGCTTGCACGGAGAAACCTGACGGCGCGTTCAAAACCTCGTAATCGCTCCCAGCGGCGAGGATCGGGAATTCAAACGCTTGCGTGGGCAAGGATATCCC
ACCTGAGCTCGTACCTAGAGAACGAGATATTATCGTGGTTAGAAACCAGTAGCTATTCAGCAGCAACAACAGCAGCAATAGTCAGTACCTTCTAAGATGG
TCAGCGACAGATTGGCTGTGGCCGGCGGCTCGTTCACGTCTCTCGACATGATGTGGACAGCACAAGTGGTGCTGAGGCGGTCGATGCCGTCGTGGTACAC
ACCGTCGTCCGATACGAGCACCAACACGTCTGCTCCACGCAGAGAATCCGTCTCAAAGTCAAAGTTCGGCGTCCTTGAGACGAAAAGCTGACCCGTGCCT
CCATGGACACCCAGGAACGGGTGGTCCAGCGTGAACGAGAACATGGTCCCAATGTCAGCGTCGCGGACATAATTACCCAGTGATAGCCCAATGTTCGTTC
CTTGATCTGCGTTCTCGTCGACAACAAACACTACGTCGATCGTGCATATCGGCGGGCTATTCTTCGTAACCACATTGACGACCACTGTCACTGAGTCCCA
AGACAGCCTCGAATCCGTCACTGTTGCCAGGATCATGAAGTAGGTGCCTTCAGCCAACACTTGAAGAGCCGCGCTCGAGACTACCGACAGCTCGCCAGTC
GTCGAATTGATCCCGATTGCACGCCGTCCGTCCTGTACTTCAATAGATAACTGATTCGCATCAAGGGACTCGAGTGAGAACGTCAGCACATCACCGCCGT
CTTGGTCGGTAGCGTGCAGCGCTCCGATCACAGATCCTGTTGGTGCGTGATTCGACACTGAAAACGAGAGCGTGCGATTGCTGCTGGCGTAGAAGTACGG
AGCATCGTTCGTGTCTTGCACGGTGATACTGACCACTGACGAAGTACACGCCATGAAGGGATCGCATGCACTCAGCTCCAGTGTGTATCCCGAGACAAGC
TCAAAGTCCAGTTGCTTGAGTAGAGAAAGCGTTGACGACGTCGATTCCGCGAACCCGAACGCTTGGTCCTCGTTTCCACTTGAGATTCGATATTTGAGCT
GCTGGTTCGAGTCCTCATCGTCGACGTTCCAATTGAAAACAGCAGAGCCCTGGGATACACTTTCGAGGACCGTAACACTGATAAACGCGTCGCTCATTGG
GGGTTCGTTCACGTCCTGGATCAGCGCAGTGATCTTGCCAGTGCTCGAGAGCCTTGGCGAGCCAGTGTCTGTTACACGTACTTTCAGCCACACTTCGTGG
TTGTTGATCTTTTCGTAGTTGAGCAGCGAGCTGTTCAGAACCTTGACTCTGCCTCCAAAGGGCTCGACGCTGAAGAGATTCGCGATTGATTGCTCAGTGA
TTTCGTACAAGAGCGATGCCGACTGGTTCAGATCCTGGTCAAAGGCAACGACAGTATAGACCCATCCGACCGCGTTCTCATTCACTTGAAACTGCGCGCC
TGGGATCTCGGGTACTTCGTTCACATCGCTCACGTGGATAAGGAGTGAGCAAATGCTACACGCCTCCAGCTGATCGCAGGTGGAGAATGTGAACTCATAC
TGATCTCTTGACTCGTAATCTAGCGTTCTTGTCAGAACGATCAGCGAGCCCTGGGAAAACGTAAACAGTCCACTTGCGGCCGCTACAGAGTCAAGCAACT
GCAGCTCAGGCTTGAGTCCGATGTCTGCTGCGTCGACGTCCTTTGTCGAGATCTTCGGCGAAATCACTGTTCCGATTGGCGAGTTTTCGCTCACAAAGCG
GGCTTCAGCCACGCAAATGGGCGGTTCGTTCACATCCGTCACTTGAACCACGATGCTCGTCGTAGAACTCAGAACCCCATCGCTCACACTCGCGAATAGG
GTGTAGAATGACTTCGACTCAAAATTCAGGACGCCACCGGCAAACAGCGATATCGCGCCTGTTGCAGCATCAATGTTGAAGAGATTTGAGTAGTCGCCGC
CTGGAGAAAATGAATACTCAAGTGCAGTGCCGTTGTCAGGGTCCAGCGCCGCGAGAACCCCAATCAAAAACCCAGTAGTTGCGTCTTCGGGAACTGAAAA
CGAGTACGCTTCTCGGAGGAACTCAGGCTTTTCGTTCACGTCTTCCACTGTAACCACCATGTCGATGGCAACATTGGTGGCAGTGTCAACATTGTCGTGC
ACTAAGACGCTCAGAGGCAGCTCTCGTGGCATCGTTTCGTAATCCAGCACCTGCTTCGCTCTCAGCTGGCCACTGCAGGCGTCGATGCTAAAATACGGAG
AGAACTCAGACGCGTCCAGCTGGAACACAAGAGTGTTGTTCTCCGGGTCCCACGTGATTGACGACAAAGGTGCTCCAATGGGCATCTCGGTGGGCGAGTT
CTCTTTTACCCGCAGTTGAAGCACACTGGTGGGGACTTGCGGCGGCTCATTCACGTTAATGACGTTGATTACAAACTCGGTGGTCAGATTCAGCCCTGGC
TTCGGTTTAACCACATCAACTAGAATCACCACCGACGACGCCTGTTCATAATCCAGCGGCTGGATCAAAGTCACGACACCCGAGTGGGGATCTATCGCCA
CGAACGAATTCGATCCGAGTATCTGGAAACGCAGATTCTCGTTCGAGACATTGTCAGGATCCGAGGCGTTTGCGATAAAGATTGACCGCGGCACAACGCC
CATCTCGGGAATGTCGACGCGGTACGGAGGAAAGACAAGCGGTCGCTCGTCAGCATTCAACACTGAGACGTACACCATCTGCTCTGACGCCAGGAGCCCA
CCGTCGATCACCTCCACCAGCAGCGCAAATTCCTGCTTTGTCTCGAAATCTAGAGCATTAGGTGAGCGAACTGTCAGGTTTCCTGAGCTCGAATCTATTG
CAAAGACGCTGCTGTCATCCATGCGGAACCGGAGGGCGCTCCACGTTGCCTTTGTGTCCTGGTCGCTTGCGACTACCGTCATAACGAGCTGCCCGCGCAC
CGCATTCTCCAGCACAAAACTGCGCTGTTCTGGCGGAATCATCGGCGGCTCATTCACATCCGCTATCGTAACCGATACAGTTTGGAAAGTCGACCGTCGG
CGTGCGGCATCATCAACGAGCAACAGCGTGCAACTCACGGATGCCGCCATTTCAAAGTCAAACTTGGACGGATCGCGCACGAGCAGGAAGTTGGAGACTG
GTTCAATCTCAAAAGGGCAGTTGCTGCCCACAATCGACACCAAGTAGTGCTCTCTTGGCTCGATCATATCAAACCTGAGAACGCCGATGTGAGCACCAGC
TCTTGGGTTCTCGTCTATCACGAGTGGCCCGATCGCAAACGCTGGAGGGTCGTTCTCATCCAAAACGCTGAGAGTCACCTCGCACGTATTGGAAAGTCTG
TACTTGTCAGTCACCTGGATGGTAAAGTGATACGTGGTCTGCAGCTCGTAGTTCAGCCAGTCGCTTCGGAAGGCCAGTTGACCTGTTTGCGGGTCGATGG
ATACGCCTGATGGACGATCTGGATTGAGCACACTGTACGTCAACGCGTCCGCAAGATCAGGGTCCCTGGCTTGCACTTTGCCCAGTGAGATCTCTGCAGA
GAATCAATACAACATTCACAATTCAGCAGTAGATAACGTCAGTACATAGTTCATAGTAATGCATGTAAGACGAAAAATCTCTTTCACCTGGTGCAGGTCC
CAGCAGTTCCAGGTGTAAGCATGGTACTCCTGTCCAGCTCACGGGCACGAGTCGAATCTGAAGCGCCTTGATGTTCGGGATTGTCACGCCAACAAAAGAG
GCATTCCTTGCATTGCGGAACGCCGTGAACAGATGCGCTTGGGTCTCTGACTTGAGCCTTAATCGCTCAAACGCAGTTGTTGCAGTGCGCCGATACTCCA
GAAAGAAGCTTTTCAGACACCCAGTGCTGCCGTCAGCGCTGGTCCCAGGGTAAATGTGCGCTCTGGACACCATTGATGGTCTTGGGAAGTTCACTTGAAT
CCACTCGGTAGCTTGTGAGTTGGACGCGGCGCACCACGAGCCAGACGCACTATCACCGCGAAGTACTTCCATTCCATTGTAGCCGTAGCCGTGTGCCTTT
AAGTTGTTCAAGAATGAACTGGCGCTCAACGAAACACTTGAAAGAACGGGTTCTGAGCCATTGCCGATTAGCTTCCTCTGGACAGTGGCTTTTGAGCAAC
ACATCAGCGTTGCACTGCCGGCGTTTTGCTGCGCTTTCGTGCTGTTAGAGAGGCAATATGCACTGGTGAGAGTGACGTTGCTTTCCAGAGGGAAAGCTCG
ATGGTATTCGCTCTGGGAGTCGGTGCAGATGGACTCCACGTCCACATCGCTACACAGTCGAAGTCTCTGGCTCTTGCAGAAGTCGTACGCGGTGTTAAAC
TCAACTGTCGAGTTGCCCGCCACGGGAAAATCAAAGAAGGTTGGGACTATTCATACAGCAGCACATTTCAGACACGTTAAGTGCAAAACCTGTAACCAAA
GGTAGAAAAGAATGAGTGCAACCAGCTTACCAGAGTACGAGAGCAATTCCTGCACCTGGGTGTCAGAAATCGCCCCTGAGAAGAAATGGATGCGACTGAT
CCAGCCCGCGAAGCGATTGTTTTGGGCTGATAGCACAGCAGTTTCTGCGATGGCTCGGAAGTTCAAGGTTGTGGAAGCTGTCGAGTCGAGTTTTCCGTCG
ACGAACAGGCGAAACGCATTGTCTGCGACTGAGTAGATCACACTCACGTACCTCCAGGAGCCGTCGGCCACGGCCACGATACTCGTTGTAGTGAAGTTCC
CCACGCAAATCTCCAGTTTGTGGTCTTCAACTGACACGCGCAACGCCGGTTCCGCTAGTTCATTCAGCGTCACTATGTTTCCCGCGCTGCTGGTGCTCTT
GATGGTCATCGCTATCGTGAAATCCAAATCTCCAAACGCGAACTGAAACGGTGGGCTCGGATCATATAGATCCTGCGTTAGTGCACCAGCAAAAAGCCCT
CCAGTTGCCGTGAAGTGATTCGCATCGCCTGCTAATACAGACACACAAACTTGTTAGATAGAAACCTCGCAAACCACGACAGGATGGAATAGTTAGCATA
CCTTCAATGAACGGAGTCGGCTCGGGGACTGTGCGAGCACCGCAGCTCGATGGTTGTAGCTTTGGTACTTCGTTTACGTTAATGACGTTGATCGTCAGAG
TGCCGCAGCCTGTCATTCTTGCGATGTAGTCGTTGTTTATTCCATCGTCGGTTGCGCACAAAGAGAAACTTAGCTGCGGCTCTGCTTCGTAGTCCAACTG
TGGTGTCCAGAGATAGATACTGGACACGTTGCGGTTAATAGCACGGAAACTGAATCTTCCTGAGTCCGGGACGACTGAAAATGTTAGGATGCTGCTAGGA
TTCGAGTCCACACCGAAGACCTGACCAATCAGCACTCCAACAACACTGTTTTCCGGTACATCGAACACAAAGTTGTCAACGACAGGAGGGGAATTCGCAC
GACTCACGTAGACTTGGACGATCTGATTCGTGGTAGACGCGAGACCAGTGCCAGTTTCATCCAGTGCTCGCACGGCGACATTGTACGAGTTCCCGCCAAC
CACCGCCTTTGCGATACGCAGATCGCCGTTGGTAGCCAATGAAAACAGACCTTCTTGGCTAGAACTGACAATCTGGTATTGAATACTCGAGGTGTTTCCG
TCTGGATCAATCGCACTCATGCGTCGGACAATGGCGTTGATCGCTGTTGACTCGGGGACATACAACTGTACAGTGTCTTGGTCAAAGTATGGAGGCTCGT
TGACATCCTCAATGCTGACAATCATGTCAACGGAAACGCTATTCGACGCACTGTCCTTGACTCGCACCCGCAGTTCCACCCTTTGCAGCTTCTCAAAGTC
CAGTAATGTTGAGTCCATCACAGTCACTTGTCCACTCGAGTTGTCCACAGCGAAGTACCCTGGTGATGGGATGGACGACAACACGTCAAAGCTCAACGTA
TCCCCAGCGTCTGGGTCCCAAAAGTACGAGCTCAGTGCAGTGCCAACTAGCGATCCTGATGGGGCGTTCTCTGGGATATTCAACAATATCACATCGCTCC
CCAGCAAGACTGGAGGCTCATTGACATTCGAGACCGAGATTGTGAAGGTTTGCAACGATGAGGCTGGGTTCGCAGCTGAGTCCGAAGCGTTGATGGTAAT
GTCGAAGCGAGATTGGAGCTCAAAGTTTACCAAAGTATTGCGGATTTCAATCTGAGCGCACGAGCGCGACGTCGCAACGATTCGAAACGCAACCGAGTCA
CTGTCGTTGGCGTAATTAGATACGTACGAGTACGAGATCGTATTGTTTTCAGGATCAAAGCCGGTCAAGCGGCCAAACACAGTTCCGCGAGGCGAGTTCT
CAGGGAGATCAAGCAGCTCCAACTCGAACGTCGGGGGCTCGTTCACGTTCAACACACTGATCCAGACCAGGGCATCGGTGCTCAAGTCGTCCTCGTCTGT
CGCGCGCACAGTCAGATTGTACAAATTCGTCACTTCGTAGTCCAGCTGGGCATTCGCAGCCACCTCAAGTTGCCCCGCACTGGTGATTTCAAACAGAAGT
GTCGACTGGATACTGACGATTTCAAACGTGAAACTCGTGCCCACTCCCTCTGGGTCGACTGCAGTCAAGCACTCTCCCACGGTTGTTGAGCTGGCCGAAT
TCTCTGCTACGCTTCGATAGATCGGCGACTGAATAACTGGACCCTCGTTCACGTCGGTGACAACGACTTGAACCCATACTTGTGCTGCTAACGGCGAAGG
CGATCCACTATCTCGTACTTCCACCAGCACATTGTACGATTGCCGACTCTCAAAATCCAACGTTCCTGCTGGAGAGAGGGTTATTTGGCCACTGCTCCCA
TCGATCTGGAACAATCCTGGCACACCTTGTGTGATGATTGCAAATATGAAGGATTGCGAGTCGTCCTGATCCACCACCTGAAGAGGCTTGCCCACAGAGG
CACCACCGACACTCGCTTCACTAATGGACCGCACGAGCGTCTGGGGAGCGATTGAATTGAAATAGTTCACCGACACATCATCCCATCTTCCATTCTCGAT
TTGGAACTGGAATGTGATCGTATTGTCAGTCGGAGAGAACACAAAGGCAGATACCTCGTGGATCCCTCGTCGCAGCGGACTGTTGAGATCACTTTCATCC
CCGAACTGGAGCTCAGAGCTCGGACGGAACGATCCATTTATCGGAACCAGGACGCGGTCGATTGTGAATTCGACACTGAGGTTCGCTTGAGAAAGCGCGC
GCACTGATACAGTCGAGGTGTTCCAGAGCAGAAAATTCCATGTAGCGACGAGTCCGTACGGCCCACCCGAGCCATTCTCGCAAAGCACTGAGTTGCTTAC
TGCGTGAAGAGTTGTGACTCGACTGGAACAGAACCTATTCGGGTCGCTGGCAGCTTGGATCGCGCTGACAAAGTCCTGTCCCTTCAAGCCAACAACAGTG
TGATGGGATACTGATCGCGTAGATACGACGAACTCGTAGTCAAGCTTCAGCGTTGGTGCCTCGTTCTCATCCAAAACTGAGACGGAGATGTTCGCAGACG
TCGACAGCCGGGGGCTCCCATTGTCCGACACTAGGATAACGAGTGTGTACTCTTTCTTCTGCTCATAATCGAGTGTAGACCCGGTCTTGACATAGAGTTG
GCCGTTGCAAGACAGTATCCCAAAGAGATCGCTGCCATCTCCGCCGCTTATCTCAAAAGTCAGCTGCTGCCCAACGTCAGGATCTATCGCGACGATCGGC
GCACCGACTAGCACGCCTGCAAGACTGTTCTCCTTCACTGACACAACAGATAGTAGTACGATGGGCGGCTCGTTCACGTCCTGCACGTTCACGAGAACAT
GAGCCACTGAGCACAAAGCAAACGCGTCGCACGCCTGAACAGACACCTGGAAAGCCGCGCGCGTCTCGAAATCAATTGCACCACTTGGTGACACAACCAG
CTGACCGTCCGAGAAGGCAAACGGCACCGGCGCGTCAGAAATCAGAACGGAGTACGTGACGCTCTGTCCCTCCGGGTCAACAGCAAGAGGCAGCGAGCTG
TCGAGAACGACCGTCCCAACGCCACTGTTCTCTGCTACTGATGCTCTAGAGATCGCGAACACTGGAGCTTCATTCACGTCCAGCACTCGGATCTCAACGG
TCTGCGTGTCACTCAACGCACCAGAATCAGTCACAGTCACTGACAAAGCGTACTTGCTGGTGGTCTCGCAGTCAAAAACTGCGACGTCAGACACAAAGAT
CTTGCCAGTGCGACTGTTGATACGAAACAGGCTGCTCACATTGCTCCCCACTAACGCAAAGCGGAGCGTGTCTCCTTGGTCTGGGTCATGAGCAAGCACA
GTGACAAGCGGGATTGAGGCATCGCTGGCAGTCGACGCATTGGTGGCCGTGAACTCACTCACCGTCCCGGACAATCCAGCAACGATCCATGGCGGTTCGT
TCACATCGAAAACATTTACAACCAGCGTCATCACAGTGGTGCACGGAGTTGTGGCGTCGTCTGTCGCTGACACAACGACCTCAAAGCGACTCTGGGTCTC
GAAATCAAGACTACTCGAGTTGACCACCGTGACCTGACCGGACGAGATCTCGATCGCGAAAATATCGGACTCCATGTGGAAAGACAATCTCCCGGCAACC
CCAAGGGGATTGTCTTCGTCGCTCGCGAGCAGTGGCGAGCCGATTTGGGTCCCCATTGCGCTATTTTCCTGTACGAAACGCGTCTGTGCGCCAAACACTG
GGCAGTCGTTCGTGTCCGCGACGTGCACTGTAACCTGGCATTGCACAGTATTCACAGCATCGCTCACTCGAACGCGCAGGTCATACACTGGGACTAACTC
GTAGTTGACTAACGCTAGATCCTGGAGAAACAGACCCCCGCTCGCGTTCACATAGAAAGTTGAAGACGTATCCATCGCGAACGCCAGTACACCTGCTTCG
GGGTCCTTTGCCACCACTTGCAGAAGCCACACATCCTTACCAACCAGGTTCTCAGACACCAAAACCTCTTGAGGCACACACATTGGAGGTTCGTTCTGGT
CAATGACGTCAATCTGAAGAGAGCAGTGGATCTTTCCAACACTGGAGTAGCTGGCAGCAAAGTGCAGTGGATACGTCGTTTGAGTCTCGAAATCCAGCGG
AAGATCGCGGCTGACCTGGATTTCGCCTGTCGTGCTGTTGATCTGGAAGCGAGCAGAGCCAAGGAGCTCAAACGTGACGTTAATAGCGCTGTGTTTGACA
ACGTTCACGACTCCAACTGATGCGCCAGGAGAGTTTTCCAAGATCTGGAATACGCTGGAAGGTAACGGACACTCAATAGGTGGGACATCCTGAATAATCG
TAATGTAGCACGTGACCGAGACATCGTATAGGCCGTCAGTGGCGACCATCGACATAATCAACGTCGCGTCGAACGTCTGCTGTAATTGCACAGTGTCGTG
CACAACCAGAAACTGGTCGCTCGATACGGCAAAGAGAGCTGACAATTGCGGATCTGCAAATGTGAAGTTGAGCGCCACTCCTTCCGGATCCGAGAGTTCC
ATCCTTGCGATTTGATAGCCCATTTCGGCGCTCTGGTGCACCGATGCATTGTAGACAGTGGCTCCCGTGGGTACCTCGTTGGCATCAATGACATCCAGAA
CTGCGACGCACGTACCGCTGAGTCCTCCGACATCAGTTGCCTCGACAACGAAGTAATGTCGCGCCTGGGTTTCATAGTCCAGCAGATTCTCGAGGACCAC
GCGACCAGCACTGTTGAAAGAGAACCAAGAGCTCGCATTTACCACTCGAAATGCAAACGACGTGTCAGTGGGATCTTCGTCTAAAACTGTGAGCGCTGTG
GAGAGAACTGTCTTGAGCGGGGCTGCTTCACTCACTTCGAAGTGCCCACACTGCGGTTGAGGTGGGTCATTCACATCGAGCACCGACACAGTGGTATTGT
AGGCAACAGTGATATCGCCATCGCGAACCACAAGAGTCACGACGTGAGAGTTGTTGCGCTCAAAATTCGGAGAGTTCTGCCCTACATGGAGCCTGTTCGT
GGACGAGTCGTAGTAGAACATACCAGGGGTGCTCTGACTCTGCAGAGTGACGATGAACTTCGCGCCTTCAGGATCGAAGAAGAGCGAGTCGATCGTTGGC
TCAACGGCTGTGCCCGTGACGGAGTTTTCCGAGGTCGTGAGGTTGTGCCCAGAGATGAGAAGAGGCGGCTCATTCACATCTAGAATCGAGATTCCAAAGA
CCTTCTCCACCGAAAGCGCGTCTGCGGACGTGTCGTGCACGCCGATAGCGACGTTGAACGTCTTCCGCAGTGTTGCCACGTCGAACACTCGTCTCCAGAC
CTCGCTGGTGCACGAAACCTCCACTAGTCGCGCCTGTCGCAGCAGCGCTACCTGGAATTGCATCGACACTCGAGTCGCGCTGGCATTTTGACGAGAGTTC
TCCACCAGTACAAACGGTGAGAGACTCTGCTCGGAGGCGTCCACCCGAACTCTGGCTTGGCTTTGTAAAACTTCAACTACCGACTGCGTGCTATTGTCGA
CATCCACGAAAACCGTTTGGAGCTCAATCACACTGTAGTTCTTCAGCTCGCCCAGAAAAACGACGCTTTCTACGACCAGACGATAGGATCCGCAGTCAAC
GGCAGCAGGTTGCAAACCTGGCAAAATCAACGTGTCGTACGAAAATGCCTCGTAGTCGAAGCACAGTGGATTCTTCACGTACATTTGGCCTGATGAAGGC
TCTATGCTGACGCAGCCGTCAAAGTCCTGCGCTATCACTGAAAAGACAACGCCGCCGCCTTTGTCTTGATCGTAGGCGACCACAGGGGTTCCGATTGGTG
ATCCAGTCGGGAGGTTCTCTTTCAGCTCGAAGCTGGAGCTCACGATGATCGGATACTCGTTCGCATCAGTCACGAACACTGTCAACGTAGCCTCACTCGC
GAGCTGTCCTCTATCAGTCAACCGAAAGGTTAAGAAATAGGAGTCCTGGCTCTCAAAGTCGAGTGCAGCAACAGTACCGAGGTTGTTCGCGTTGCCATCA
AAGCGAAACGGACACCGTACAGCAGGCGTACACATGACCATAGACAGAGCCATCGTGTCTCCAGCATCTGGATCCGACATGACGGCAAACGCGTTCGCTT
GGACTGTCACATTTGCATTTTCTTGCACGTAAATGTCGGAAACACGAAGTGTTGGAGCTTCATTCACGTCAAGAACTGTGATGTTTACTCCAAACGATGT
TGACTGGACTGGCACACCGTTGTCACGGACTTGTACAACCAGTGCATAAACGTTGTTACTCTCGTAATTCAGTCCAGCGGATCGTCGGTACACTGCAAAG
TTCTGACTCCCTCCGCAGCTCGAGTTCATCGTCCCGCCGCAAATGAGATCGCAGGAGGTGTCGCTTAGTTGGTCCTGAACCAGCGCTGGATTCAGATTGC
TGCACAGGCATTTTGAACTCGCATAGAGCGTCATAAACTGGTTTGAAACGCAGCTTCTGGAGCAATCTGACATCGACGCAGACGAAGACGATACGTCAAC
AGTGGATACAATAGACGCATCTTGGACACTTTTAAAACAGCCCACAAACGCATCCGAAGGTCCTTTCCCCACGAGAAGCTGCCCAGAGCCTGAATTCAAC
GAGAAGAAGTTGCCGTCATTCCCGCCGACAATGGAAAAAACGAGTTTTTGACCAAAGTCAGGGTCCGAGGCAACGAGAGGGAGTCCGATCGCTTGGTTCT
CCTTACTGTTTTCGCGGATCTCTCTGGTCTGTGTCGGCTGCGCCACAGGCGGCTCATTGACGTCAAGTACCTTCACAACCAGCAACACTTTCACTGCAAG
CGGCTGCTCAGATCGAACTTCCGTGGTCATGAGCTCCAGAAAATGCACGGGGGTTGTTTCATAATCAAGCGCTGCCTTGGCGACTATGAGGGTTCGATTC
GTCACGCTGAAGAGCCCGAGTGAGTTCCCGCCAGTGATACTCACCACTATGTCGTCGCCATCGGGGTCAGATGCTTGAAGCGCGCCAACAAGATCCCCAA
CTGCAGCGTCTTCCGAAATACTGAGCGCCAAACTCGAGTTCATTCTTGGTGCTTCGTTCACGTCGATGATCCAAACTGTGATTGGCGCTGACGAAGTCAA
GCTGATCGAGTCCCGGACCTGGACAATCAGCTCGTACTTGTTGAGCATTTCAAAATCAAGCTCTTGGGTACTTCGACGAATGTAGCCGGTCGACGCTTCA
ATCTCAAACGCGCTCGAGAATTCGTTGCTTTGAAGCAAGTACGTGAGATTTGCTGCTCCAGTGTCTTCGTCATCTGCGAGGACGTAATCAGCTGGGGCTG
AGAGAAACAAAGAAAGAAGGGACACAACGTCAATATTGAACGCACCTATCGTCTTAAGAGAGACAGAGCATTTACAGGTCGTCACTTACCAAAAGCAATG
ATCGAAGTTCTTGGGTATTGAAGACCTTGCAGCTGCGAAACGGTGATCCATGTCTGGCTCGAAGTGTTGAAACTCTGGACCGCGATCGCAGAGACGCAGT
TGTCTGCGTTTAGCGCTGTCTGAACAGTAACTTTCGACGCATCGACCCTGGTTCTGAACTGGAGCTCGATCCATTTTCCTGCGTCTCCACTGTCCGAAGA
CTTCAACAGCGCCACAGTGTTCTTGTCGCTATCCATCGCAAGCGTAAGATCGGACCCGTCTGAAGCTGTAATCGAAGCCAGCGCGCTCACAAGATTCACT
TTCTTTCGCTCTGAGAACCAGCTCAACTCTGCGATCCCAAGAGGTCCAGATCCAAAGTCCGAGACGACAAGAAGGCGCCATCTCGTTCCGCTTATAGTGG
ACATTCCCCAAACTGACAGTGAAGGCGGACCATTGGCAACTGAGGCCACGCTTCCACCTTGAGCCATTATTAGAGTGTTGCCGGCCCCGCTAGTATCAGT
CAAATCTCCATCGAACCTGCAAGACAAAAACGTCCAGGTAGTGAAGGTTAGCATGATGCTTGCGGACGAAAGGCGAGAGCCTGAGCGCAAACCAATTTGG
CTGGTTGGTGTACCTATAATTGGCGATCAAGCTTGACACACCACCAGGCTCAATTCGACCGAGATTGTTCTTGATGTAGTCAGCTGCCTTGACTTCGCTC
CACCAACGAAGCTACACAAAACACACACAACGTCAAGCCAATCATCCAGTGTGACAAAAAAAACGATTCAAACAAAGACAGAGAATGACACATACCTCGT
CGATCAAGAACGTGAACGGCTTCATTGGACACGCGACGCTGCTGTAGCACGAGCCGATGACGAGCTCTCCACCTGAGTCGCACTTTACTCCACCGAGCGA
CGGAATCCGCGTCTGAGAAATTGAGATCCCATCAAGATATAGAATTGCGTCTCCCGTGAGGCCATCGAACGTCACAGCCATATGATACCACACGCCCTGC
GTTAGCTTCGTCTTGGTGCTGACCGCGACGTCATACAGGATAAGCTTTAGACTCTCTGACGAGTACGAAACCTGGATGATCACACGCGTCTTCAAGGTTA
CTGTCTTCGTGTAGGTGAAGATCGCCCCCTCGTTCGCACCGATCCGAACCCAAAACTGGAGTGTCAGACCTGAGGCGGACGTGACAAACGTCACGGGGTT
TCGATATACAAACTGGTTCTCTGCAGTGATTGACAGCGCGCTCAGGGATTTGCCGCCTGCGAGCAGGTCGTACCGTTGGCAAGTGCTGCAAGGCTCACAG
GTGGTAGGAGCTTCCTTCAAAAGTGCGCATTGCGAGGCTGCCTCGTCAAAGATCAAAGACTTACAGAGCGCCAGTCCGCTGCAAAGCTGCATGCACACGC
CTGAGGATGTTGTCGAACGGACACTCAGTCTTGTGCTCAGATCGGCAGTTTGATTGCATGCTCCTTGGTACTGGAATCTCGGCTTTGCGAATGTGCGACG
ACCTGCATTTTCCTCAATAAACAGGTGCTGCCTCGGCACGAAGAACGGCGTCTCGTCCACGTCCTGCACGTTGACCGTGAAATCCACACGAGCTGTAGCT
CCAGCGTGGTCCTTCACGACCACGCCAACTGCGTACAACGCCCGCATCTCAAAATCAACAGAGTCGAATGTTGAAAGCTGATACGACGTCGCATTCACCT
GCGCCAGCGCCAACACGCGAGAAGAATCTGCGAGCGCGATTGTGAACGATTCACCGGCATCTTCGTCAGCGATCAAGAGGTACCCGACCTGTGATCCGAT
GGGAGCCGACTCTGGGAGGTTTGCCACGGTTGCGGACGAACCAGGGTATGCTGGAGAGAAGGTGATTCGAGGCGGATCGTTCACATCCAGCACTTGTACA
ATCACAGTGAGCACCGTCGTTTGTTTCTCGAGACGTGCGTTTCGCACCAAAATCGAGACGTTATAGCTTGATTTGATTTCGAAATTCAACGCGCGAAGCG
CTGAGAGCTGCCCAAAAGTGCGATTAATCGTAAACTCAGAGCTCGAATCCTGGATTTCGAACAAGAAGGATGTGGCAGTTCTACTTTTCGTGTCTTGGTC
TGTACAGGATTGCCATAGAGTGGTTCCCAAGAGAGCGTTTGGCGCGTTGTTCTCGGCGATGCTGAACGACACTGTCGCTGAACACACAGGCGGCTCAATC
TCGTTCAGAATCGCGATCACAACTGTGCACTGAGCAGCCAGAGGCGCCGGTGCGTCGTCTTGAACTCCAATCACCAGTGTAAACAGGTTGCTCGCCTCGT
AGTCCGAAATGTTGGTGCCGACTGTAATGGCGCCAGTAGTGTCGTTGATTTGAAACATGTCGTAGTCGTCACCGCGCGAAATTGCAAACGAGAGCGTGTC
GCCCGCGTCTTTGTCACTGGCG