Description :
From Genome Similarity Track
Location :
Scaffold_59:26022- 28255
Transcript NameFunction/comments
Hyaar_Emoy2807068N-acetyltransferase 10
Hyaar_Emoy2807067KIAA1709 protein putative
Hyaar_Emoy2807070predicted protein
Hyaar_Emoy2807069predicted protein

Sequence
2233 bases(100 bases per row)
TGCTGGCGAAGCTGCAGCGCGTGCTGCCGCGAATATCCATGGCAACCAAAAGCGTCGCAAGGGTGAGCAGAAACTGCACGAAGAACGCTGGCAGGCAGCA
AGTAGTGCTGCTCAGGCTGCAGTAGCTGGAAGTGCTTCGTCTTCAGCACGTGTACTTCGTGAGGTGTCGCTTGAGACACCGATTCGTTACGCTCCTAATG
ATCCGGTTGAGCGCTGGCTGAACGCTCTTTTGTGCTTGGACGTGACGAACGCATCGCATCGCCTTGTAGCGGGTACGCCTCATCCGCGTGATTGTGAGCT
GTTCTACGTCAATCGCGATTCCCTGTTCTCGTACCACAAGCTCTCGGAAAGTTTCTTGCAGCGTATCATGACGCTGTACGTGTCATCGCATTACAAGAAC
CAGCCAAACGACCTGCAGCTTCTGTCCGATGCCCCGGCACACCACGTGTTTGCCCTGCTTGGTCCTGGTGCCGAAGCTCAGGGTAATGCTGGCCAACTGC
CAGACGTCCTTTGTGTTGTCCAGGTGGCTCTGGAAGGAGAAATATCCAAAGCTTCAGTGAAGGCCCAGCTTGCGCGGGGTCAACGTGCTTCGGGAGACCT
CATTCCGTGGACGGTGGCACAACAGTTCCAGGATTCCGAGTTTGCTGCTCTTTCGGGGGCGCGTGTGGTGCGTATTGCCACACATCCGGATGTCACTGGC
ATGGGCTACGGCTCTCGAGCTATTGAACTGCTTGCAAAGTACTACCAAGGTGAAATCACGACGGACGTAGCTGGCACTGAGTCGGAAGAAAAGGTGGACC
AAGAAAACGAAGCGGACGATGATGATGCCGATGAAGATGTGGAAGCAAAGAAGGCCAAGCTTCGCAAGGAGAAGATCAAACCACGGAAGACACTTCCACC
TCTCCTGTTGCCGCTGGAGGAGCGTCCATGTGAGCGCCTGCACTGGTTCGGTACGTCGTTCGGTCTGACGCTACCACTGCACAACTTCTGGTCTCGCGCA
AAGTTTCGCTCAGTGTACATCCGACAGACAGCAAACGACCTCACTGGCGAGCACACGGCTATTTTGCTGCGCTCGTTGCGCTGTGATGATCTCCCGGCAT
CTCCAGCAGACGGCTGGCTGGACGAATTTGTGGCCGACTCACGCCGTCGATTCACCTCACTGCTAGGCTACGACTTCGCGAAGTTTCCATGTGCGCTAGC
GCTTGGCTTGCTGAGTGATGAGACTGTTAGTTCCGCACCCGATATCAATGAGGACAAGCAGACTCCTTTGCACCGTGGTGCTACCGGTGAGATCAGCCCT
GCAGAGCTCGCGATGGTGCTGACGCCATACGATGCGAAACGTCTCAAGTCGTACGCCAAGAACATGGTGGACTACCACATGATTGTGGACCTGGTGCCGT
CGCTGGCGCGTCTGTACTTCCTGCAGCGCCTTCCGCAGATGTCATTGTCGTATCTGCAGCGTGCGATTCTTGTAAGTCTTGGACTGCAGCACCAGTCTGT
GGATGTGATTCAGCAGGAGCTGAACATTCCTTCGAACCAGCTCCTGGCACTGTTCAACAAGGCTGTACGAAAGTTCTTGGGTCAGATTGAGCAGCTCATG
GAGAAACAACTGGAGCAAGAAAGCGAGAACAGCAAGAAGCTGGCACAAGTGGCCGCGCAATCCCAAGCCATGGCACCAACTGAGACGACTCTGGACGAGG
AAATGCGCAAAGGCGCTCAAGACGAAAAAGCCAAAGAGCAGCAGAAGCTGCTCGACAGCCTCAACTTGATGAAGTACGCAGTGCGCGGTGATGATGCCGA
CTGGGACTCTGCGCTTGCTCAGACTGAGAACGGGGGTGCTGTTGTGCAGGTGAAGAGCAAGAAGCCGACAAAGTTAAACAAAGAGGTGAAAGACACGGAC
TCCTCGAACAAGGAGCACAAGCACAAGAAGCGCTCGGGCGACGGTGACAGCGATCACAAGAAGAGCAAAAAGAAGTCAAAGAAGGGCAAATACGCCAACC
TTAGCTAGAGAAGGAGAAAGCGATCGAGTACGTACGCCAACCATTGGTAAACTGTTCCGTCAGTCTGTTGTCCAGCTTGAGGAGGTTGAGCAGACTCCCT
GGATGCCTAGAAGAAGTACCTAAGAAAGACCATGATAGCACTTGAATTCGATCTCCTTGAGCTAGTCGTCTCCGTGTGCTTTGGATTCCGATGGCGTGCG
CTTGACGCTCGGTCCTCGTCGACCATGGTACGT