Description :
From Genome Similarity Track
Location :
Scaffold_844:2602- 5413
Transcript NameFunction/comments
Phymu_g12136vacuolar protein sorting-associated protein 35, putative

Sequence
2811 bases(100 bases per row)
ttcgtgctggacgagcagggcgaagaagatctgcTGCGCGAGGCACTGCAGACAGTGCGTGACCAGGGCTTCCGCATGCAGCGCGCAGCTGATGCCGGAG
ACCAGCCAGCCGTGCTCAAACACGCCGCTGAAGtgctgcgtgagctgcgcACAAGTCTCCTGTCCCCGAAGAATTACTACCAGCTCTGTAAGTCGTGGCG
TTACGCTGTAATATCTCTAACGTACTAACAATCGGTGCTATACTGCAGACATGCAGGTAatggacgagctgcggcACTTTGAGAGCTACGtggaagagca
acagcaggcGGGGGCCTCCATGCGGGTGCTCTACGAGCGCGTCCAGAGCAGTGGCAACGTGCTGCCGAGACTGTACGGCTGGATGAATTGCTCTAAAGTA
GTGGAACCAATGGCTTATTATaagctttttttttgtgATGCAGCTACTTGTTGGTGACGGTGGGCTCCGTATACATCAAGTCGCGAGAAGCCCCAGCTCG
GGACGTGCTGACAGATCTAGTGGAGATGACGAAAGGAGTACAATACCCGCTACGAGGGCTCTTTTTGAGGCATTATTTATCGCTTAGTGTCCGCGATAAG
CTGCCGGACACGGGCTCTGTGTACGAACAATCCGGTGGTGGCACAGTCAGTGACGCTATTAATTTTCTGCTGCAAAATCTACGAGAGACCAACCAGCTTT
GGGTccgtctgcagcaccagaagaTCGGTACGTCCAGACCTCTGGCTGTCCGAGAAAAGGAGCGAATGGAGCTACGACTGCTGGTCGGGACGAGTCTTGT
GCGGCTCAGTCAGATGGAGGGAGTTACAAGTAGCGTCTACGCTGAGCAGGTTTTGCCTCGGCTACTGGACGACGTTGTACTTGCCTGCAGGGACTCCATG
GCGCAGCAATACTTGATGGACTGCATCATCCAGGTTTTCCCTGATGAGTTTCACTTGCAAAATCTCAAAAAGTTGCTggacgcactggagaagacgcagc
cCCATGTTGACGTGGCTGTGATTTTGACGGCACTTCTTGAACGCCTCACTAAATTTCGGGAGACTCAAGGGACTCTCCTCAAtgaagaccagcaagagGC
TGGAGCGGACGAGCGGACCAAAGTtgaactggagcaacaaGAGCGACTTAAGGTGTTCCAGCAGTTGATGGCTACGACCTCGAAGTTGCTACTACAATCG
TCGCGATATGTTGTTGGAAGTGGAGAGTCTCCCAGTGATGGAGACCGTGGTGAGACGCACTTAGCCTCTGTCTTGTCATTTTTCGTGACGTTCGCTACCT
TCACCCTCGCGTGGTTGGGTAAAATTTCCAAGAACAGGAACTCCGACACAACAGTAGCGCTACAGCAGGTAGTTTCCGGGTGCATAACGTTTTTGCGCGA
ACGAACAGCCTGGCGTGTTGACAAAGACAAACAGAAGCGACAACTGGTGGTTTCACAGCTCGAATCTCTCGCGCTCACGCTTCTACGAGCACTCTCGATT
CAAGATCTCATGCAAGTGCCGGTTCTCCGTGAACTGCTTACTCTGATGCCGTGGCAAGGCGCATGGAAAGATGTGGCGCTCGCATGGATCCGTGTTCTCC
TGGCTAGACATGAACGTGTCCACACTGAACAGCAAATGGACTTCTTGTTGCAGGTATTGGCGCCATTGGTGCGTGACGACCCCAACGAGTTGCAGtcacc
gcctccagcaacaacaacggaAGCAGGAAAAGGCAAGGAGGCAGAGGTTTTTgaagcagagcagcaaaCGCTGGCCAAGGTCGTCCACCTGGTAACGAAC
AACGATCTCGACGTCAAGTTTCGTGTGTTTTCTGTGGCAAGACGTGCATTCCTGCAGAGCGGCGTCTTCCGTATTCGTTTCACACTTGTGCCGTTGATTT
ACCAGTCGCTGACTCTCGCGAGAGACCTCGCAGCGCATTCTAAGGAGAAAACACAGACTCAAGGACAAGAGACTAAGGCTGAAGCGGAGTCTGCAGCGTC
TACTGGGAACGCCAAGACGTTTGCCACAACGCCTCGTGAAGTCCTTCAATTCGTTCACGAAATGGTGACGGCGCTGGCTTCCAAGCAGGATGCGCTCTCA
GTGTCGTGTGTTCACTTGTTCCTGCAGTGTGCGCTGGTAGCTGATGGCTGTGCTTTCGAGGCTGTAGCCTACGAATTCATCACCCAGGCCTTCATCGTGT
ACGAAGACCAAATCACGCTTGCTCGAGAACAGTGGCGAGCCTTGGAGCTAATGGTGGCATCGCTTCGTGCTACTCGCAATCTTTCAAGCTCTAACTATGA
AGTTCTCGCCACTAAAACCACTCAATACGCCGCTCGAttgctcaagaagaatgAACAGGCCTTGATGGTGCTGAATTGTGCGCATCTCTTCTGGGTAAGT
GCCTTCTGTCCAGTACTTTGTGGTAAAGGAACAGGGCTAACACTTGTTCACTTGGCAGCACCCGTCTCAACAGGACGGAAAGCGTGTTCGAGAGTGCCTT
CAGCGCTCGCTGCGTATTGCGGACGCTATCAAGGACACGACTTCGAACCAAGTTCCGCTTTTCCTGGAGATACTGGAGGCCGTACGTTGACTTAGTTGTG
ATTTTCTCACCTGTAGGCGTTCGGCTGACGTTTTCCCTGAATCTCTTTCTACAGTATTTGTACTTTTTTGAAGCGCAGACACCGGAGGTGACGCAAAACT
ATTTGGCGGGGCTGTTGGCACTGGTGAAGGACCATTTGGATAACATGGAGCACGGTCACATGCGCAGAGAGGGCGAGTTCCGTTACCGCGCCATCGTGCG
CTACATGGATA