Description :
From Genome Similarity Track
Location :
Scaffold_433:2602- 4953
Transcript NameFunction/comments
Phyke_g9418hypothetical protein PHYSODRAFT_286359

Sequence
2351 bases(100 bases per row)
ACTAAAGAAACGTTGCTTTTGTATATGAGACTAGAAGACCACACAACCCCCTTGCTGTTAAAAGTCAAAATGGCATTAGTCCTACATCTCCTCACTGTAA
ATAAAAGAGAGCTGACGGACGGACAACGCACCACCAACGAAAAACCAAAGCACTAACTCGAGCGTGGGCCTCCAGCAACCGTCCCGCGTCGCCTCTGGTC
TCGCCAATCCTCACCTCGTTAAACTGGTTAGGACAGTCACTGGACTCTTCCACCCGATGACTCTTGACCTTCCTGCCGTCGCTGCATGCCACACCCACCC
ACTGCGCAGCTGCCCAAGCCAATTATACACCATATGAATCATGCAGAGCCTCCCCTGCTGCCATCGGCCGAAGAGTCTCTTCGCCGCGAGTAAGAGAGCT
AAACCCACGCCTTGAGTCTCGACCAACTACCAGATCCCCGGTCATCAAATCATCAAACACATCCCAGCACGCCTCGCCAAATAGTCAAAACACTTTCTCT
TCCACTAGGCGAAGGAGACGCACGCATCGCGCTTGTATTGATTCCCGACGGTTTGATAGCAACAAAGGCCAGCAACGCCACTCGACTTgtcagcttccag
ctcttcatcctccgGTTCCTCTCTTCCCCCAGTTCTCCCCTCCTCCCTCCTGTTGTcgccgtcgccatcgttccaccatcaccattgtcatctcttcatc
caaCACTTCGGCGACAGCATTACGACTTCCACTTGGTCGACACCCTCTTACTTGGTAGCCTCCGCTTGACGCAGGTGTGCTGAGCACAGACCTTTGCGTC
GGCATGGCTTACTGCAGGCCTCCATCGTGCAGCGCTTGCCGCCGCCGTGGGTGGCGCACAGACCTCCGCCGCGGTCGTTGCGCATGCAGCCTGGCACCTC
GCAAAGACGCGAGCCACCGTGCAGCGCACAGTAGTCACCGCGCTGGGTTCCCTTGTCACACCCGTCGAACATGCAGcgcttgccaccaccgtgcgAGCGG
CAGAAACCGCCACCCTGCGAACTGCGCGAGCAGCCGTTGAACTGGCAACGCGGGCCACCACCGTGGGCCTTGCACAAAAAGTTTGACTGCGCCGCCTTGT
CGCAACCCTCGTGGCTGCAACGCTTGCCGCCACCGTGACGGATGCACAGGTTGCCTCCCTGGGAGCTCTTGTCACAGCCCTCCACGGCGCAacgacgacc
accaccgTGGGAGATGCACAGACCGTTCGAGCGCGAACGCTTGTAGCATCCCTCGCTCTTGCACAGCCGACGACTCTTCATCTCACCAGCCTTCACCTTG
GTCTCAATGTGGGTTTCCGGCAGACGAGGGGTCATCATGAGTTCCGTGTCAGTCAGTCCCTCCAGAGAGTCCATCAAACCCTCAATGGGGGTCCCCGCCA
GCACGTTCAAATTCAAAATGCCgtcgtccacttccaccgccttcttcttgtcctccgGGGCGTCGACCAAAAAACTGTACAGAATGGACATCTCCGTACC
GTCAAATCCATCGTCCAAGTTCACAAGGTTCGGTTTGTCCTTGTCCAAGTTCTCCAGTTCACTGGGCATAGAGAAGTCCAGTaattcctccagctcctga
GTCTCAAAGTCTGGCTGCGTAATAGCATTCGACTCCGGCTTGACCTCCGACTCGAGGGGGGCGGTGACGAACTGCTCCGTCGACATACTGAGGCCCATCA
AATCCGTGTTGGGGGCGGCAGTCCATGGCATCGTAGGCATGTTGGTGGCCTTCGGGAACGACACGAATGGAAGCGCCGGGGGCGGCGCCGCCATGCTAAG
CATGTTCATGCCATCCGCAGTGAAGGGCAGGCCCTCGGCGGTGGACCAAGCGGGCGCTTGGCCTATCTTGGCGTTCTGGCTCATCATGGCCTTGCTGGCT
GTCGGTTGGTATCCCGCAAACAGCGCAACGGCTGCCGGGCCCATGGCGCCCAGAGAATCGCGTGACTCTATAGGCCGGCACATTCTCGGGCTGGTTCTTT
CTCTCTTCGCTAAATCGCTGCTTTCCTGTGGTTAACACTGTTCGCTTCTCTCGTTTTCGAGCACTTTGCGTTTATGAGGGCGGTGCGACCCGTAGGACGG
CTGGGTTTTCTTCCACGGAAAACGCCATGTTCAAATGGCCCTGCTATTTCGAATtagaagaaaatgaagaacGCCCATTGGCTCATAAACAGATTAGTAT
TGACCTGATTGTGTGAGGAACACGGATTGAATAAATAGAGAGCCAGTCGTACAGCTGGTAGGGTAAGGACAACACCTGACCTCACTTTCACTCGATTTTT
GTAAGCGATCTGGAGCGACAGGGGGATCAGGAAAGGGGAACGCATAGAAAC