Description :
From Genome Similarity Track
Location :
scaffold_1111:2602- 4845
Sequence
2243 bases(100 bases per row)
CTTGCGCGAGAAGCTTCAGCAGCTGAAGCAGACAGCGGACATCGAGTCCTACAATGGCGTTTTTCGCGTCGAAGGCATGAGTATGATCGACCAGGTGTTG
TGTTATGCCAATTGTCGCAAGCCCCGTACGCGAAGCTATGTGAAGCTCGAGAACCCTGAGACACTGAGCGACGCAATGTACCTTGCTTCGGAGATCTGTC
GAGGCGAGAGGTCTATCGGCGAAAAGACCCGATTCCTGTCGAGGCGCCGCTCTGGAAACGGATGTGACGTCCGCGGTCAGACGTGCTCGTGATGCAGTGG
AGAAGGAGAGCCCAAGTGTTGTTCGAGAACAACAGCAAGGCACGTCAGCCGGCGAGGGTTCGGCGGTGAATGGCGACCCGAAGTCGTCCACGTGCGAGGG
TACTGTGGAAGCGCTGAGGATGGTAGCAGTACCCGAGGCAAAGACACCAGCGTGGGGAAGATGTTCACGAAGGGTGTTGTTGATGAAGTAGATGTACATG
GTTTGTACATCACAAGGAAGAAGCTGAAGAAGTTCATGAGAATCAAGACCAAGTCAATCGAAGAACCAGACTTTATGTTGGTGTTGTCCAACGAAACGAT
CAAGCGGGTCGCTTGCACACTGCAATGGCAAGATCAACCGGTCAGTGTTGTAACCGCGAAAGCTCAGCGATATCCTGAAACCGACTGGGAAAGCTTTCAA
GATAATCCTGGCTTCAACATTCTCATTGAGTACAAGGACAACATGTTCCGCCCAGAACTACCTGAAGGCTTACCGGAGAAACGTGGGATCAAGCTCCGGA
TTGATGTGAAGGATACAAATCTCGCGATGTACCAGCAGCAGTGGCGACAATCACCAGAACAGCAACGTGAAATTGTACGATGGGTCGTCGACATGGTGAA
GAAGAAGCTCATTCGGCCAAGCATCAGTCCACACGCCGCACCGACGTTCTGTGTTTGAATACCAGTCGGCTGGAGGATAGTCCATGACTACCGGTATTTA
AACTCCAACACGGTGCGACAAAGCATCCCAATGACGCGGGAGGAAGACATCTTAGACGCGATGGCATGATCGTACTAGTTATCCACAATGAATTTGATGT
CCGTGTATTATCAGGTGCGCATGCGTGAGGAAGACATTAAGTTTACTGCCTTCCAGGCCCCAAACGGCCTCTGGGAGTACCAACTACTACCAATGGGAGT
ATGCAACGCGCCTGCAACAATGCACAGACTCACGTCGAAGATCTTCCAAGACTTGAAGAACACGAAGTCGTTCTATGATGATCTACATCTTCACAAAGTC
ACCCAGAATCGAAGATCACCTGGGTGTACTACGCGAGACATTAAACATTCTGCGTGAGAACAAGCTTTACGTTAAGCTTTCCAAGTGTGTCTTCTATGCC
GAAGAGATTCCATGCCTAGGAGACTTTGTTGGGCGAAACGGAGTGCGTATGGATCCCGATAAGGTGCAGACAATCAAACATTGGCCAGTACCACGGACAC
AAGAGGAGCTGCACAGCTTTCTTGGCCCGGAATACGCCTCGCTAACATCATCAATGTTACCCTGCTGAAGAAGAAGAACAAGCTCAACGCGAAAGTTCAC
TTCAATAATGAACTACTGAAGAACTTTAAAGAGTTGGAGCGACGGCTGTGCAACCCACCAGTGTTGCACCTGCTAGATTTCAGTCAACCAATGCATCTTC
GTACAGACGCTAGTAAGTTCGCTGTCGGTGGAATCCTATTCCAAGTCATCAATGGGTTGAGCGCCCTATTACATACACCAGTCGCAAGATGAAACCCGCG
GAGCTCAACTACCCAACACAGCAACAGGAACTCTTGGCAATCGTCGATGCGCTTGCAGCCTTTCGGATATACTGCTTAGACAAACCGCCAGTCGTCGAGA
CAGATCATAAAAGTCTTGAGGGTTTATTCACTCAGAAGATGGCGAATCGTCGTTTAGCGTGGTGGTATGATATCATCACAGAGTATCAACCGACGTTCTC
GTGCGAAGAACGGAACTGAGGCGAAGGCCCGATCTGCAACCAGAGACCAAGTCCTTCCACGACTTGAGCTTTATCGGTTTCAACGATACATCATTCAGCT
TGGCGATAATCGACGTGGCCATGAGCTCGGACACCATCTCGCAGATCAAAAGGCGTACAACAAGGATCGAGAGGTAAGGACAATCTTTTCCGCGACCAAC
CTGCGCTACACAACCCTGACACACGAAAAGCGTAAACAGCATC