Description :
From Genome Similarity Track
Location :
Scaffold_1438:2602- 3911
Transcript NameFunction/comments
Physo_126721reverse transcriptase
Physo_145506reverse transcriptase

Sequence
1309 bases(100 bases per row)
CACGATCACGGCCCTCGTGATCGTGCTGCATCAACGCACATGCGATTGCAAAGTCGGATGCGTCACACACAACGTCGAATGGACGATCTTGGTCGGCTGA
CGCCAAGATCGGCGCCTCAGTCAAGCCCCGCTTGACTGCATCGAAGGCCTGCTGACACTCAGCAGCCCAAACCCACTCGGCGTCTTTCTTCAGGAGCTGT
GACAGTGGGTGTATCATGCCTGCGTAGTCCTTCACGTACTTGCACAAGTATGTGGCCAAGCCAAGGAACTGCCGCAGTTCCTTGACGTTCGACGGCGTCG
ACCACTCATTGATCACTCTGACCTTCTCATGGTCAGGGCGGACACCGTTCTTCCCGACGAGACACCCGAGCACGGGTATCTCGCTCGCCCCGAAGATGCA
CTTCTTCAGGTTCGCATAGAGCTTGTGCTTGCGCATGAGCGCAAGCAGCTTCCGGTGATGCACCTTGTGTATCTCAACATTGCTCATCCCGTCCGCAGCC
CGACTGTGGACGAACACATCGTCGAAGTAGCTCGGTGTGAAGTCGCGCACCGAGCGCAACAATCGCGTTACGCACCTGTTGAAGGTCGCAGGGGCGTTCT
TCAGACCCTGCGGCATCACTAGCCACTCCCAGAGCATGCCGCTCGGCGTGCTCACAGCCGTGAGAGGGATGTCGCTCTCACGCATGAGGATCTGATAGAA
CCCATCGCGCAGATCAAGAGCACTGTAGATAGTGCTCCTGGCCATCGAATCGATGATGACATCTTTTCGCGGTATCGGTGTCTGCGCCGGTATCGTCGCA
TCGTTCAGCTTGTTGTACGCATGAACGATGCGCCAGCCGCCCTGTGGCTTCTTGACACAAAACGTCGGAGCACTGTGCGGGGATTTCGATTCCCGCACTT
GTCCAGCTTTGTGACGACTCTCAAAGAAGTCGTCGATCGCCTTGACCAGCTCTCGCGGCAGTGGCCACTGCCGCGTGACACAGTACTTCGTGCCCGGCAC
GAGATCAATCTCGTGCTGGATGCGTTATCCTGCGGAAGCTCCGCAGGAATCTCTTCCAGGAGTACGTCCGCGTACTCCCGTAAGATCTCGTAGTAGGGGC
TCGTCTTCAATGAGTCCCAGCTCTGCTCTTCAAAGCGCTCCTTCTTCGTCTTCGCACTGAGAGTGTCCTCGCTCTCAGTGGTGCTCTCCATGAAGAACTG
CCTCGGTTCTTCATTCTCGCTCTTCGTTCTCTCGGCGTCCGAGAGAATGCATATTTGCTCGATGCGTCCATCGTGCAAGTCACGCGCGAAGCGCTTCCAG
CTCATGACT