Description :
From Genome Similarity Track
Location :
Scaffold_259:26019- 33105
Transcript NameFunction/comments
Phymu_g7667hypothetical protein
Phymu_g7668hypothetical protein PHYSODRAFT_327098

Sequence
7086 bases(100 bases per row)
CATTTGTAGGGGACTTTGGCATGAATATGAACGGCGGAGACAACCGCTTCATGAACCAGTTCAATTTAGGCGGAAATGGCGTCAATAACGGTATGGATTT
GTCCGGCGGTCTGGACTTTAGTAGCGGGATGAACCTCATGACGGACTCATCCATGATGCTGGGCGGTAACTCATCCACATCCACAGCGGGGCTCATTGAC
TTTCCAGACGAGCTTAACTCGCCCAAGACTGCAAGCAGCGGcccgagcagcagcatgatGATGGATACGTCGTCGGCCTCGGCGCCAATGACGTCAACGG
CGGACGCGATCCCGTTCCCAGCATCGCTGGCCTCCGAGTCGCTTACGAGCAGCGGtacgtcttcctcgtcgtctggGGGCCTGGACGTGATGAATTTTAT
GAAcacgaccacgaccagcagcgccatggGCAACAATGCCAATGGAATGGGCCTTGACATGAACATGGGGCTGAATATGGGCATGAATATGGGGATGAGC
ATGGGTATGAACAACAACATGGGCATGGATATGAGCGGCATGAACTTCGGCATGAACGACGGGAACAATATGATGTTCAACAACATGCAGCACATGAACA
TGATGAACTCGCAACAAAACTACTACAtgccccagcagcagatgcagcagcaacagcagcagcactacaTGCAGATGATGCAACAACAGCGTCTGAATat
gcagcgtcagcagcagcaaaaagcaATGCTCGAGCGCCAGCGACtggcccagcagcagcaaacccAGAAGAACAACGCTAATCAGCAGACCcttccacag
cagcagcaggctgcgcagcagaagcaacagcaaatgcTCGCAGCAGGTCAGGTTCCATCTCAAATGGCGGCTCAGAGACAGTTAAGTGGAGGAAACCCCG
GTGTGAATGCTGCACGCTCTCAGTCTCAAGCTTCGACCCCAAATACTGGAACAGCGACACCTTCAGCTCGACCAACATGGCAGTCTTCAGCGGATCAGGC
GCTGCGTAAGGAAATGCTGAATCATATTATGCGGGTGCTTCAGAATCAGCGGTCAAATGCACCAGCAAATtggctgcagaagctgccggagaTGGCTCAT
CGACTTGAGGACGAGTGCTACCGCATTGCTACGTCGCGTGATGAGTATGCTAATACGAGTACTCTTCAGTCTCGTTTACGTAGTATTGTGCGTAGTGCCC
AGACACACCAGCGTAATATTGGAGCGAACGCCATGAGACAGCCCGGTGCACCGAACCAAGCCCCTGCGAATGCAACCCCatcgacttcttcgtcagcagc
gaTGCCCATCCCGTTTCCTGGTGCTCAAGCAGTTGCTCCAACGTCGAGCGGAGTTTCCTCGCAGGTGAAAAGCCTTGCTGCACATGCTATTCAAATGCCA
CCGGAACTTCAGGATCCTCCATCTCAAGTGAATACTCCAGTCAAAGTAGATTCGTCTCAAACGCAAGCACACTTGACGATGGATTCCTCTATGACGGATC
GTGCGTCTTTGAGTGGCACGGGTATCTCGCCTCTAGCTGGACAGAATGGGGTGCAAACGACACCAGGGCCTGCTGGTTCTAATGCAACCGGGAATTCAAC
CGGTTCTGCAGCCAACtcgcctgcttcagctgctcgtAACAAATCGGCCCAGATCATTTGGCAGTTTAAAGCTAAGGCCCAACAAGTTACTTCGGCTTTG
GATAAGAACCAGACAGCGGAATACCACAACAAGCTGCGGCTCATGGTTCGTGATGATGTAAAAACTGCTGGATCAAAGGAAGTATTACAGCGTCAACAAC
AgcgattgctgctgcttcgtcacGCTATGTGGTGTAAATCGGCTGAGGGCACGTGTACGACTACGCCAAGCTGTGGTGAGATGAAACGGCTCTGGGCCCA
CATGGGTGCATGCCAGCAGACAAACGCGTGCTCCTACAGCCACTGTATTTCTTCCAAGTACGTGCTCTCACACTTTCAACAGTGTGTAAACCCCAAGTGT
CTCGTGTGTCAGGTGGTTCGGTATCCTGTCGAAGTGAAAGAGAAAAATGGAGCTTTGATGCTTGATGCAGACCGTGCGTTGCAACAGATTATTGCAGCGA
GTCAGCGTCGACAACGCATGCTtgcgatgaagaagcaacaggagatgcagcagcaacaaatgCACCAGTCTGTGCCATTGGCAATGCCTGCACACCTACA
GCAGCCTCAAACCAATGGTAGCATCGCACCAatgaacttccagcagcagcagcagcagcagcagcgaaacgCCGGGCAGAATATCAATCATGGCACTCCG
GTAGGTGCAAACATGACCTCCATGGGGATGGCGATGCCGAACGGAGGCAACCGCCCTGCCTCAATGACACCCAACGCAGCGCCGGTTGCCAATGACATGA
TGCGTCAGCAGTTTCCTGTGAAAGCAGAAAGCACTGTGCAGCCGACGAACCTTGTCCCTGATGACCAACGACAACTCCAGCTGATCAAGCAGAAACTAAG
TGGGCGTTCTCTGGAGCAGCTAACGGCTCATTGCGTAAAACTGGAGAAATGGGTGGAGGAAATTCGTGCGCGTATGAACTCTATTATGAACGAGTGCCGA
CAGCTACTGCATCTGTCGAACTCGACGCAAGATCCGACACAGAAAACCCAGTACGAATCCCAGGTCCAAGAGAAGCGAGTTATTCTTAAGCAACTGGATG
TGAAGTTCAAGCAGTGCAGAAGCCAGCGGAATATTGTGAAGCACGTGATTGATGAGCGCAATGCTACCGCTACTCTATCAACCTCAAATGGTATGAATGC
CTCGAGTGCGATGCAGGCAATTCCAATGCCCGctcagatgcagcagcacaattCTTTCGGCCAGCCGCAGGCATCACCTGCTAGTGCTTCTGTGACACCA
AAGCCATCACCAGATGATCTACTGATAGAGGAAGATGATGTTCCTTCAAAAGTTGATGGGGGTGTTGCAGTCTCGGGAAAGCCTCTGGAAATGCCCATGG
ACCTACAAGATACAACTGCGACTCCTGTTTCTGTAGCTGCGCCGTTGAACATGTTAACAGCACCACAACAACTGACTGGAAACCAGGCTACGACAGCTAC
GACTGGCCCCCGCCCGGGGTTACCGATGAACCACACCCAAGGGCATGGATATGGGCATCATCAGGGTCAAATGCAAGAGAATGGGAAGATGAGTAACCTG
TCAGCAACTCCAGGGGCGATGGGTGTGACGGTAAAAAAGGAACCTCAAGTGAAATTGGAAGCTTCAGGAGTGGTCAAGGAGGAAGTGGCCATCAACCCGC
TGACGATGAACAATTCCAAGCTGAATGCTATGATGTCAGAGCACCGCCGAATGGATGCCAGCACGAGCTTGCAGCTGCCTGCTGGTGCGGTAGGCACGCC
AAAAGCGATTATCACGGCAAACGGGGGAAATGcaacgtccagcagtgcaggcgcagcaacaccagcgccgccagcttcgtcgGAAGTTCCGATGTCTGTG
CTGAACGAACTGAGTAATGAAGACTTGGCTTCTCATGTGGACTCGCTAGTGACGTACTACAATGCAACGGTGTCCCCAATGaatttgaagaagaaattgg
AAGTGATTTTGAAGGGGATGATGGATCACAAGTTTGGATGGGTGTTCAACTCGCCTGTGGATACTGTTGCGTTGAACATCCCGAACTACTTTAAGATTAT
CCGGAAGCCGATGGACCTGGGGACTGTCAAAAAGAAACTCGAGGCAGGTATCTACAAGCACATGGATGAATTTGCCTTTGATGTGCGTACTACGTTCCAG
AACGCGATGCAGTAcaacagcgaagacgaagacgttTATAGTCTTGCAAAAGACATGCTGTCGGATTTTAACAGCGAAATGCGCAAGGTTGGAGCCGAAA
TTGAAGTTGATGAAAAGGCTGCGCGTGCAAAGGAGAGCTCTTGCCGGCTTTGTGGTATCGAGCGCATGGTGTTTGAACCTGCTGTCTTGTACTGCAACGG
CGAGTGTAACAGCCGTATCCGACGGAATTGCTACTATTACACTTCAGCAGATAACAAGTATCACTGCTGCCACCAGTGCCATGCTAGTCTTCCAGATACC
ATCAAGCACAATGAAGGCCGCCAGTACCAGAAGAATGAACTGTCGCGAAAAAAGAATGACGAAGTGCATGAGGAGCCTTGGGTACAGTGCGACAAGTGCG
AGCGTTGGGTTCACCAGATTTGTGCTCTTTTCAACGGGAAGATCGACAGTGAGAAGAAGCCACAGCTCGTCAAGACTGAGGGAGGTCAATCGACTGATAG
CGGTGATacatcttcgtcgccttcagCGTCCTCCAAATCTACCACGGTCACTACTACGGTGGTTAAAAGTTCGTCGGCATCAGGACCGAAGGGGACGGTG
CACTCAATCACGACATCCCCAGGCAGCGAGTTCCTGTGTCCAGAATGCTTATTGGAACATCGCAAGAGTGAGCCGCAGAAGTATAAGATCGGTCGCCACG
CTTTTAGTGCAAAGGACCTGCAGCGCACGAAGCTATCGGATTTTTTGGAGCGACGTATTACCAAGTCACTGCAAGCAGAGCGTGAGGACGAGGCGAAATG
GACGCAACGTGACGTGAAAGATGTTGAGACTGCGGATGGTCTGACAGTGCGTTTGGTCTCGAACATTGAAAAGCAGCTAATGGTGCGCGATAGAATGTTC
CAGCGGTATAAGGACTCGCACAAGTATACTTCGGAGCATCGCTTCAAGTCCAAGTGCATCTGTATGTTCCAGGAGATTGACGGCGTGTCGGTGTTACTCT
TTGGTATGTACATACACGAATtcgacgagcaggaggcggaTTGCAATTCGCGTCGTGTGTATATCTCGTATCTGGACTCGGTGAACTACTTCAAGCCACC
TCACCTTCGTACGAAGGTGTACCATGAGTTGCTGATTGCGTACTTCGACTTCGTGAAGCAGCGCGGCTTCCACACAGCGCATCTATGGGCATGTCCGCCT
TTGAAGGGCGACGATTATATCTTGTACTGCCATCCAGAGGCTCAAAAGACACCCAAGTCTGATCGCTTGCGCGCATGGTATGTGGATATGCTGGTCAAGG
CTGAAAAGGAAGGTGTGGTGTGGCAGATCACGAATATGTATGACGATTACTGGCGCAATGACAACACGCCGTGCGCACTTCCGTACTGCGAGGGCGACTA
CTGGGTCGGCCTGGCTGAAGACTTAATCGAGAAGTTGGACGCCGAGAAGCCAAAGAAAATCGTCAACAAGCGTGGTTCTAAGTCGCACAAGCGTAAGAAC
TCggacacgaagaaggcagcgAACAAGAAATCGAAGTCCAAGAAGCCTAAGCGCCGAAAAACCGCCGCTGGTGGAGAGGCCTCTGgtgatgaggatgaag
acgacgatgcaCACGAAGTCACCCCGTCGGCAAGCAACCGCACGCTGACGGTGAAGTCGCTGGATAACCCCGACCGGAAGCTATCGGACCCTTTAATGCA
CAAGCTTGGCGAGGTGATCGAGCCTATGAAGGACGATTTCTTGGTGGTCAAGTTGGTGCCTTGCTGTCGTGTGTGCAACACGTCAGTGGTGCAGGGCGAT
CTGTGGCTCGACCACAGTGTGAAAACGGAGGGCGGTTTGAACCCGAAGGTAGTACAGACGGCGCTTTGTGATGGATGCTACCAGAAGTTGAAGGTCGTAT
CGGTCGCAGGTTCCTCCGCAGCCCACCACCGACTGCAGACGCGGTTGAACGCTCTCACTAAGGAGACGGTTGCGTTACCCGAGCGGTGCACGGACCCCGA
CGAGATCAACGACAGTGAGTTTTTCGACACCCGCCAGGCCTTTTTGAGTCTCTGCCAGGGGAATCACTACCAGTTCGACGAGTTGCGGCGCGCGAAGCAC
TCTTCCATGATGGCCTTGTACCACTTGGGCAATCCGAACCCCAACGCCTACGTGTACGAGTGCAACGCGTGCACACGCGACATTGTGACAGGTAACCGGT
GGCATTGCCACACGTGTCCAGACTTCGATGTGTGCGACGCCTGTTATGCGAAGGAGAAGCATGAACATCCGCTGGAGATGGTGCCAACCAGCGGTGGAGG
CGTTGCCGGGGCTGGTGCAGGTCCTGCTGGGCCTGGAGGCGCGGCAGGGGGGGCCGCTCTGTCGGCCGagcaacggcgtcttcgcGAACAACGAGCCAAG
AACGTTCGGTTGCACATGCAGTTGCTGGTTCACTCGAGCTCGTGTGCTGACGGCAACTGCGGTTCGTCGAActgcgagaagatgaaggagctgatgcGCC
ACGGAGCGCAGTGCAAGCAGCGTGCGTACGGCGGCTGTACGATCTGTCGGCGCGTGTGggcgcttctgcagctccacgccaGACAGTGTCGCCAATACGA
GTGCAAGGTACCGCGCTGCCACGACCTGCGCGAGCACGTCcgcaagttgcagctgcagcagcagctcatggacgacCGTCGTCGTGCCGCCGTGACCCAG
CAGTACCGTCAGATGCAGAGCGAGCgccagcaggagcagcagaaccaaGCTCAAGGCGACGACCCCATGCCTCAGGCATGACCGACAGCACTAGATCGAG
CGGTGAGGACCAAAATGGTGAGTGTAGCATAGGATAGGGCAAACCATATTAGTTGTAGATGTGTGTCAACGTGGCTGAAGTCTCTGCAAAAACAAATGAA
AGACGTGGATCAAGCCCGCGCATACTATTAACTGCTCAAGAGGGGGAGTCTTTCTAATGTGAGATACAGACAGCGGCAGGTCGATCGCGGCTCCTTCTCT
CTATGCCTTCTTGGCTCCGAGTCGTTTCTGACGCCGACGGTGGTGCGAGCACGGACGCTTGCCGTGGTTGGCCTGTAACCAAGAAACAAAAATGAGTATT
TCCTCTCTCCAGTGAATTTGTGTCTATCTCGACCTTCTTCGGACGACGAGCGTTGcggttcagcagctccatggcaATAGGCGTCTCGAACAAGTTGGTC
GACGGTACGCTACGCACGTTGGCGACTGCCAGGGCGGACGGACGTGCTGCAAGGAGGAATGACACACAGCGATTCAGGCAGTGAGA