Description :
From Genome Similarity Track
Location :
Scaffold_304:26019- 27288
Sequence
1269 bases(100 bases per row)
CGTGGGCTACGGCAAAATATTTGCTCCGGTCATTCGATTAGTCACTGCGAATGCTACTGGCACTAGTTACAATAAACGACTGGGAATGTCACCAAACCGA
TGTAGACACTGCGTTCCTGAACGGCAACATGACCGAAGAGGTCTACATGCTGCAACAGGAGGGTCCGGAGACAGCCAGTCAAGAGCATCTCGTGTGCAGG
CTGATGAAATCATTGTACGGGTTAAAGCAGGCGCCAAGGGCGTGGCATAAGAAGCTGACAGATTTCCTGAAAATGAACGGTTAAGTGCAGTTGAACAGTG
ACGCCTGCATATACGTTCGCGCTGGAGCAAGTGGAGTAGTAATAGTAGGAATTTATGTCGACGACCTGCTTCTAATAGCAGATACTACGAGAGGCGTGCA
TGCGGTTAAGAGCATGCTGGCATCAGGATTTAAGTACAAGGATATGGGTGAGGTACACCACATTCTTGATTTTCGGGTACGTCGAAATCGAATGTCGAGT
ATACTCAGCATTACCACTTACGCGAAAACGTTATTGAGAAGTTTAACCTGATGCAGCTGAATCCATGTAAACTTCCCTGTAATCCGGGCGTTGTTCTCTC
GAAAGAGGACACTCCCAAAACGAAGAGCGAACGAGAGCAGATGAAGGGCAAGGACTATCGAGGCCTGGTCGGCTCTCTAATGTACCTAATGACAGGAAAC
AGGCCCGATATTGCCTTCGGTATCCAGTGCATGAGCAAATACTTGAATAATCCCGGCATCACTCGCTGGAACGCCGCAAAGTGAATTCTTCGCTACGTGA
AAGGAACGATTGGTCATGGACTTGTCATCGATGGATGTAGTCGCAGTGGACTGCAACTAACGACGCTAGTGAACTCAGATTATGCGAAGGACACAGACAC
AAAAAGATCAGTATCGAACTACGTGATGCATATAGGTGACTGTGCGATAATCTACTCGTGTAAGGGTCAAAGGACGGTGGCATTGTCCTCCACCGAGGCG
AAGTATATGGTACTGGCACATGGCGTGAAGGAGTTGATATTTCTACGAGAACGGTTGGACGAGCTCAATATGCAGCAGGATCCTTCAGTCGTGAACGTGG
ACAACAAGTCGGCAATCGCAATGGCAAACGATCCAATTCATCATCAGCGAACAAAGCATATTCATTCGCGGTATCATTTCGTGCAAGAGCGTTTCGTCAT
GGGTGATCTTATCATCGAATATGTAAGTACAAAGGATAGCGTGGCAGACTTAATAACAGAAGCTGCGAC