Description :
From Genome Similarity Track
Location :
Scaffold_1272:2600- 5554
Sequence
2954 bases(100 bases per row)
TTACGCTTAGAATTCACTTTTTCATACAACATTCAAGTCAACTGTCTAGTTATCAAATGGTGAGGAAATGTGACCTCCTATTCGGGTGGCTCTCTTGAGA
GGACCTACCCGAGCATTAGAGCCTTCGGAATTGCTTGAGATCTGGCCGTCCGCCATCAAGCAGGGCTCACTTGCTTGTTAGTCCACACTTAAGACGACAA
GAGTCGTATAATCGAAGCAACCAGAGGATCATCATGATCTACTATCGTCATCTATTTGATTTACAAACTTGAGATACAATTTATCACAAACCTACCAACC
TACTGTACCGATGCTGTTTTCGCTACGCTAGAGCTCCTCCTTCTCGTCGTCGTTGACCGAGACGGCCGAGAGGTTGCTCAGGCGGTTGCCCTCGCGTGCG
ATGCGCTCCTGTTCAGCCGCCTCTGCCATCTCCTGGTATTTTTCGGACAGAACCCACTCGCGACGGCGCACGAAGCCCTGGTAGCCGCGGTGCTTGCTCG
TCTTCTTCTTGTTGTTCGGAGGCGCCCGCACGCTGTCCATACCGACACTGCCCCTCCGAGACACTAGCGGCCCACTGGCGCTGGACGGGAAGAGCGAGAA
GTCGGTCGCGTAGATCCAGCCGTCCTCATCGCATCCGGGCGCGTCCAGGTTTAGTTCAAGGCCGGCGAGCGGGATCCGCATGGCGCTCAGCTTGCCCGAG
CGGTCGCTCCAGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNAGCAGGTAGCCTGGGTACGTGCTGCCAAAGCCGCAGAAGGGCTGGTAGCGCTCGTTCTCGAAAACGACTGGGTCGTCGGACAGCAAAATCTGCTG
GCGCACGTGGACGTTGATGCCCTTGCGGCGCGACGGTGCCGAACCGTTCTCCGGGTTGCTACCGTTGTTCAAGATCCAGTTGACGATGTGTGCCGGCTGG
TCGAACGCAAAGCCACGGTAGAGCGGCGCGCGACCCGGGGCCGTGTACCGGACCGGCACGCGGTCCAGCACGCGGCGCTCCTGGTAATCCATCATGCTGG
CCAGCTCCGGGTTGAGGTAGTTGGCTGCCGGCGGCTTGTAGTGGAGCAAGTCCTGGTATGCCGGCTGATTGGAAACAGGTGACTCGGGGTCGACAGACTT
CATGCACTTCGTTCTCGTCGCCATGGTCTCTCTCACAAGATCACGGTAGTCGGGCATGAAGCGACGTCGACAGGCCTCGTAGAAGTAATCCTTGAACAAG
ATCGCGACGACCGCGAAGAGCTGGCCGAACCAGAAGCCCGCGCGCGCGAAGATCCAGGGAAACGTGTACGTGTTATAGTCGGGCGACGTCCAAACAATGA
GGTCGATGATGTACTGGAAACCATAGAGCGCGAGCACCGTGAGCGCCATGCAGACGACTTCGAGTACGTCCCACGAGTTGACCATGATGCAGAAGCGCGC
GCTGACGACGATACAGAGCACGGTCCAGGCCGCGCTCTCGAGCACCGTGTACTCGACGGACTCACCGTGGCGCATGATGTTGGGCACGAGCACGAGCGTG
AAGAGAAAGACGCCGATCGAGTCGATCACGCCCAGCAGGATCCATTTCCAGAACATGAGGTACGAGAAGAACGAGTGCTTGCGCGTGGACGAGTGGTATA
GCGCTGGGAACTGCAGCACGACGTCCTTGGGCAGGTCCCGGTTGAAGACCGAGTACACCATGATGGGCAGCGCCGTGAAGATCAGGTTGTACCCTTGCTG
GATGAGCGCCGAGTAGATCATCGTGCCAGAGTATGCGGTGGGCGTGAGCGCGTACCAGAAGAGCGACACGTTGTAAACCACGTTTTTGTAGAACGTGTAT
ACAGTGAGCGCGGCTATGCGGTCGTAATTCCAGCGGCCGTGCACGAGCAGCAGTGTGCTCAAGAACCGGAACTGGCCCAGCGCGTAGTCCGAGCTGTTCA
CGGCTTGCATACCTTCCTGGCCGCTGATGCCGATGCCGATGTGCGCGCTCTGGATCATGGGCACGTCGTTGGCGCCATCGCCGATCGACAGCGTGTGCGA
GTCGTGCACGTTGAGCTTCACGAGCTCCACGAGCTGCGCCTTCTGCTGCGGAGACACGCGACAGGCGACCACCACCTTGCAGAGCAGCGAGACGCGCAGC
AGATGCAGATTATACAGCGGGTCTTCGAGGATCAGGTTGAGGCAGCCGCCGTCGATCACCAAGGCGTGCTCGACCGGGTTTTTCCTGGTGCCACCAGCAG
TCAACACGGTTGGCGTGGCGCTAGCGCTGCCGTCAAAGGCGTTAGTCTCGTTGCTGTCGTCACTGCGAGTGTCGTAGATGGAATGGAAGACCTTGTCAAG
TTCGCGCAAGATGGACCCCTTCGAGCGGTAAGTCGCAGAGTTGATCACATGGCGCTGCATGTCGTTGTTGAGCAGGCGACAGGCGTAACCAATGTTGATG
GCCGTCTCCTCCATGTCGCCCGTGAGCACCCATATGCAGATGCCGGCCTTGGCGAGCTGCTCCATGGCCTCGGGCACGCCGTCCTGGAGTCGATCCTCAA
TAGCCGTGGCACCCAGGAGCTCCAGGTCGCTCTCGAGCTCGTCCTGGAGCATGTCAATCGTGTTCTTCTCACCACGGGCCTTAGCATCCACCTCCTGCAG
GTCTGCGCACGCTCTACGGTAGCGTAGGTGGAAAGCCTCCCACTCTGTCACGCTCATCTTCTTGGAGCAGATCACGAGCGTCCGGAGTCCATCCTGTGCA
AAGGTCTCGAGGTTCTTGAGCGTCGCTTCGCGGGTCTTGGCGTTCAAACTGGAG