Description :
From Genome Similarity Track
Location :
Scaffold_1519:2600- 3945
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1519-snap-gene-0.6Vacuolar protein

Sequence
1345 bases(100 bases per row)
GGTAAAAGAGATAGCGGCTCTCCGAGGACGCAGCGAGCTGGTGGAGAATCGCGGCGGCCAGCAGCCGTATCCGCGAGTCCTTGGACGAGCAGCACTCGAG
CATGTAGGCGAAGCCCTCTCGCCTGGCCACGGCCTGGCGCATGTCCTCGGTCGTCACCAGATTCTTCACGAGCTCGAACGCGGTCCGGCGTAGTCGTAAG
TCGTAGGAATGGAGTAGACCAAACACGCACTCGAGTCCGCCGGGCGCCTGTAAGACCTTTAGTTTGACTGCGTCCAGCCTAGCCATGTTCACGAGCGTTT
GAGCACAGTCAAAGGCGATCGCTGAGTCGGTCTTACTCTCCCCGGCACTGAGCATGGAGATGAGCGCACCCAGCGTCCCGACTTCGGAGAGCAGCTCCAA
ATTGGCCGCTGAAAAAACAACGCAATCGGTCAATGGATCAACTAGAAGCAGAGAGTGGATCGCTCGGGACGTACGGTTCCGGCTGAGCGAGGCAAGCGCG
GCTGCGGCGTCGCGCCGCACTTCGGGGAAGGGGGACCAGTACGCGATGTCGATGAGCGGACGCACATTGTCGGCGTCCACGTCGCGCTTCTTGAGCGTCT
GTCTCACTTGCGCACTGCGCACTGCGTCCCGTCTCGTGGCCACGGCGACTTCGAGCTGCTGGTCGAGCGTGAGTTGTTTCCTTCGATCGGTCCGCTCAAG
TGCGGATTCCTGGTCAGCCTGGTCGCTGGTTGCCTTGTGGAGCCGCGTCCACGTGACTTGAGAGAGCCGCTTGGGCGAGCCCCGAGCGATCGCGTCGAGC
TGCGCCTCTCGAAACACCGATGCGCGGCGCACTGGGCTGTTGTCGTCGTCGGCGAGCGATGGCGGCAGCTTGGTCGTGAGGCGACGGGCCGAGGTCACGG
GTGAAACAACAACTGGCGGTGTTCGTGCACTGCTGTCGTTGGGAGGAATGGTGCCATTCTCTCTGGGGCCATTGGAGTGCGAATCAACATGCGCTGTCCG
TGCTGCTGACGTCGGACGCCGCGTCGGTGGCTTGCGTGGCTCTGGGGGGAAGAGATCCGGAGGTGGCGCGTTCCATTGGCGGCGCGCGACTCGACCAGGT
GCCGCCGCTGAGAGAGGGCGCGACGTCAGCGCAGCGGGCGTTTGTGGTTCTCTTGGTGGCGGAGCGACCGTGCCGATTGTCGGCATTGGCAACTAGGGAG
ATGGGATTCGTCGATCTCTCACCAACATTGGGAGCTCCTATTTCCGTCAGATGGCTACATTGTGGTGATGTGGATCATGTGGACCATGTGGACCATTTGA
GTTGTACAATTCATGATAATGAATTGCAAAATGAATTGAAGTCAA