Description :
From Genome Similarity Track
Location :
Scaffold_1119:260- 6924
Transcript NameFunction/comments
Phyag_g9563hypothetical protein PHYSODRAFT_254379
Phyag_g9564hypothetical protein PHYSODRAFT_545950

Sequence
6664 bases(100 bases per row)
TATATTGAAAGAGCGCTCCTCGTTCATCCAGCGTGCGCAAACCATACGTGTCTTCTCTGTACTCGATAGTGTCGTGCATTTCCACCATAGTCAGACTCTC
GAACTTCgactcgatctcgtccaacGAGCTCAATTCGCTGTAGTGTCCAAGCAGAGATCCTTGCCAGGGTGACACCACTCCATCCTCAGGAGAAGCGAAA
AAATGAGCCTCCTTCAGTTTGAGAAAGTTGTTTTTGCGCCGGATCTTCTCCAAGTGGCAGTGGAAATCGAACCACGCGCACAGGTTGACATTGTTGATCA
TCGGCAAGAACTCGTTGGTGGCCACCCACACGTCACGTACTGGAGTTCGTCCCAAATTTGAGATCGAGTATGCAGCTTGAATCGTGGGGTCCATCGATCG
TCGAGCCCAATCGGCCTGCATTTTTCCACGGTAACCTTCGGGAGTGTATCCCGTGAAGTCAAACAAGTTTGGCGGCAGCACCGCAGCACCGAATCCTGCA
CCCATGTCGTGGATCGAGTTACGATCGGCCTCCTGTGGTCCGTAGAAGACGCCGTTCACCCCGCCTGCCAAGCTCACGAAAGTGTGAACCTTGTGGCCGT
CCATTTGCTCGATTACGGCGCGAGCCATCATCGCCCCCTGCGAGTGACCAATGAAGATGTATCCGTTCGCGAACCGCTCGTCGTTGGCCACCACATCCCG
AACCGCGGCAATGGCCATGTGTACTTGGATGTTCAACGCTGTCAATGAGCACTCCCTTTCACAAAAAGCCAACGGGACGAAAACTCGCCCCTCAGCTGTG
AGGTTCGCCTGATAGTTGAAACCTTCGGTGCTGTTGCCTGTGAGtccgtggaagaagaagacggggAGGTTCTGCTTCTCGGTTGATGAAGCTGGGATAG
TTGTAGGGGTGCCAGTGTTGAGATTTGTCGCCACAGACGAAATGGAGGACTCGTCGAGGCAAACGTCGCTTCCGATTTTCGGGATGGTGTTCGTTGGCGA
TGCAGACAGTAGCAGAGGCAGAATCGATGCCAGGAACACTTGGAGCGCGCGCATTTGTACCGATCGACTTGTGTGCTTGGCGGAGACTTTGCGAATGAAT
CAGGTACATCAAGGGAAGGATTCCAAAAACCGAACAGAGGTAAAGTTCAAGAACCAGTCATACCAACCAAGCCAATTCGTGTTATTCGGGGAATTATAAA
GAGAAAGGAAAAGGATGCAGCGTTCCTGGCTCGATCGAAGCTGTTGATAGTGCTAGCAAAGTGATACCCCTTGAAGTTGAAGCCCAGTCGTATCATGCAT
GATGCTGCATCTTACTGGGGGTTCTCCCCAACACCACTGTCCGACTTCGAGGGTGGAGGGTTGCGATCACCCGGCTTGCCAGCATCCTTCGGGGGAtact
cgtcgctgcctgCATTCGGTGGGCGAGGGAAGTGTCCATCAAAACTTCCGCTGCGAGGCCAGTGACGTCCTTCATTGCCGCTTCCGACAAACTGGAGATC
AGCGCTTccatggtggtgatgatggtggtggtggtgcgcgCCGTGAAAGTCGCGATCGTCACTGTTTGCCGACATCTCGCCTCGGGAGAACTGCGAACCa
tcagcaagagctgcagtaGCAGCCATTACAGCGACGATAGTGAAGGTGAGCTTGAACATCGTGGAGGACGGAGGTCGCTCTTGATCTTGGATTGAGGTAG
GTTGATGAGCTGGTGCTTCGATTGGAGTAGATTGGAGAGTGAGAAGATAGCGAGTGAGGTTGGCAAGAGTGGACGACTACGGTGGTTGTACGAatttctc
caccaacacggGGCGTTGACCAGATCGGTCGCTCGGATAGCTCAGGCAGGCAACGCCAACATGACACGTTGGTTTCGTGCACCAGGCGCTATAAGGAAGT
TGCCTCCAGTCTTTAGGGTGTGACTGTAGTTGCCGGATCCTGTCCTGGCATGGGACGTTGAGACTTGTCCACCGAGAAGCTTGACGCTGTCCGACGCTTA
TTATAGCGTCGGACAGTGCTTCAGCCAGCGCTCGACAAGGGCCGACAGCTTAGTTCTAGGCGAGAGCTGTCCCATCGGCGTTGTCATTTACGCTACCAAC
AGTACAAAGAGAGACAGGAGGGGTAAACACTTTTGtggagcaacttcaacttgccctGTAGCCATGGTTTTGGTGAAATCTGAAGTTGTAGTTTTTATTG
AAGTCATTTTCGCTCACGTCACCTAGATGCCAAACCACATGCACATGTGACTCTATGGAGACCGccagctcagcagcgcgcgTTTGGCGATAAAACTGCC
TGGCAAACATGAGAAGAGCCGCAGTATCAACAAACAGTTAGTGCTTTCGATGGGATAACAACACTGTTTTGCTTGCAACTAGGtgcgagagctgcaggtt
ATATCAGCGTGTTCGCAAGCACAAAACGTCTACGGTTAATCAACGTAGTCTCTATTGCTGCAATTGGATTGACTTGATGACCGCTTCTTCGATTTACACC
AACTTTTTCAGCTACGAGCTAGGTCAAGAAAGTCGCGCGGTATCTGGTTCGAGGCATTCGGTCTTATAGCGAGTTTGTCCCACGAGTCGTGGGCCTATAG
CCCGAAAGGATCAGCTGCCAGTCGTGCACCGAAAGTGTGCTAGCAATGTTGTGAGAATGCGCCTGCGACGACGAAAACCGACGATGGTGACTTCGGTTAC
GGCGTCGTACGCCAAAAGGCCCATGGCGCCACCTCATTCGTTTCTGGCGACGAAGTCGTGAACCGGAGCagcgagatgcagcaacatTGGCTCGTGTTTA
AAGCAGGAAACAATATGCCAACCAATCTCGACGGATAAAACTGGGCTAAACATGCAGCTGAGGCGCGGTTGCCGCGACAACGTTGTTGCCAGATTTTCCA
ACCCACTCTGCACTGATTCGGCTCTTGCGCGGCGGTGGACAAGATTTCCTGCTTATTGGCGCAGACAGgtgttgcagctccatcgatCAAGAGCCAAGCG
CCGATCGGATCGATGCAGAGTGCAAATATTTCGCAGACTCCCGAGGGATCCGCGGGCGACTGTCGATTCGCGTGGCCAAACGAGCGGCTCCAATGCACAA
TGGCGCGGCAGAAGCCCCAACCATGACATTTCCCGAAGCCATCTTCGGGGATATTGTGGGAGCCGTCTCAATAATACGGTGAAAATCGGCAGCCATCACT
CCATTCTCAAATTTCTCCAAGAAAATCCGTTCGATTGTCTAactttcagccaatcagacgCAACCTCAACGTTCTATaaagttgctgccgctgccacgaA
GAGCTCCCGGAAGAAGGCCAACACGCAGTTACGCGTGATGCCTTCCAGCGCCTCCGGTGCCGCCACCTTTGTGGTGGCTGTGGGTCGTGTGCTGCGTTTG
TGTGGTTGGGGCGGTGGCTTGTCTCGCTTCGTTCTGTGTCCCCATTGGTGAAAAGGTGGGGAGTGGTCTGTCTCTGGTCCGCGCGCGCTGAATATTTGCG
TGGGGGTTTCCATACGAAAGTCAAGTCAGTCCCTCTCGTGCTTTCTCCCTCTTTCGCACgctccatcgccatcgcagtcgcagccacAACGGGAAAACCC
CCAGAGCGGAGCGAAGGAACGCAAGCGCCAAAGGTGTCGAACCCCCGTCGCTCTAGCGTCTGAGGTAGCATCGGTGACATCCACACCGAACCCACAAGCT
ATAGCCACCAACCGGGCCATGGCGCAACGCGGACCGTCGGGCCACGGCGAGATggaccgccgccgccgcgccaGCTCCAACTACTTCGAACTGGACGCGG
ATCGGCGGCGCAACAAGTCGGAGCGGTCGGCGCGCTTCAGCTCCCGCCTCAACACGATGGACGTGACGCCTGCGAGCGCAAAGGGCGTCGCGCAAGACGA
CGAGGCCGCGATCGACTACTGCTGCGAGTTCCTCAAGGCCAAGTTCGGCTTCCAAGAAGGCTCGGCCAGCAATCAGCGCGaacacgtgctgctgcttttg
gcgAACGGCAAGGCGCGCTGCTTGCCCAACGACGCAGCTGACGCGCACCTGGTGCAGCTGgcgaacaagctgctgtccaaCTACCGGTCGTGGTGCAAAT
TCATCCACGCGCAAACCGTGACTTTTTCCGGCAGCGGCATCCCGCACTCTACGCCTTCGGGGAATTTGCACATGGACGTCATGCTGTACTTCCTCATCTG
GGGAGAAGCCGCGAACGTGCGCCACATGCCAGAATGCGTATGCTACTTGTTCCACCAGATGCTCACCATGGTGAACCAAGACCCCGAAGggcgcgagcag
cagcaagaaggctgGTATTTACACCAAGTGATCCGCCCAATTTGGCGCGAAGCCAGCAACATGAAGCGCAAAAACGCGCTCAACAAGCCTCTGGAGCACG
TGAAAATCCGCAATtacgacgacatcaacgAGTACTTTTGGAAACAGCACTGCCTCAGCATCCCCGTCACGAAAGTCGGGGAGGAGCTGACGCAAAACCA
CGGCAAAACGTTCTACGAGCACCGCAGTTTACTGACCATGGTGCTCAACTACTACCGCATCTTCCAGTTCAACATGATGTTTCTGGTGCTGCTAACCGTT
TTGGCATTTGCGGTCACGATTTCGCCAGATGGCGGCAAAAGTGGCTGGGTGCAATTCGGCCGGATCGGAGATGTGGTGGACCCGTACACAACGCGGGATT
TGAAGTTGGCGGTCGTTGCGATCCCCTTCAGTTTGAGTCTCATGGCCTTTTTGAAGTGTGTGATGGAGGTGTGTCACGGCTGGCACTTGTTGATCTCCAA
AGAGAGCTCGGCCACAAGTTCGCGATCTTTCTCGTACGGGTCGGCGTTAGCCACTCGCATCATTTGGAATGGCGGCTTTGCGGTCTTATTTGGCATTATG
ATTTACGTGCCGCTAAACGAGGACAAAGACACGACGCTACTGGATAACCTTTATCCACTTTGCGGCGCGTATATCCTGCCGGGCCTTTTGGTGTTGCTAA
CGCAAGCTTTTGCGCCACAAGTCATTAGCGGCACTTTTGCGGCCAAATTTGTGCGCGAAGGAGAGAGTTGCTATGTGGGCCAAGATATGACCCCACCCTT
CTCGTACCAAGTCAAGTACATTGTGTTCTGGATCTTATTGTGGATCGTGGAAGCGATTGCGTCATACTTTATCCTCGTGCGGCCGTTGATGCTGCCGACG
TTGAGTATTTACGCCATGACGCTGGATTACCAGAATTCCTTGGTGTCGTTCCACAATATTGGAATTATCATTGCACTCTGGCTGCCGGTGGTGTTTATCT
TCAATTACGCCACACAAATCTACTTTACCATTTTTCAGGCACTACTGGGAGGATTCCAGGGTATTCTCATGAAGACGGGCGAGATTCGTGGTGCTAAAGA
GATGACCAAGGCTTTCCGTGTTGCACCTCAATTGTTCGACcagaaggtggtgacgcTTCTTGCGCGGTCGAGTGATGCTTCTGCTACTGGAACGGATTCG
ACCCGTGCCAGTGCTTTGGCTGCAGCTTACGAGTCGCAGATGATGCTGCGTTTTGTGGTGGTGTGGAATGAGATCGTCAACTCGTTTCGTGAAGGAGATC
TTTTGGACGATAAGGAGGCTGCTATTCTTCAGTACGATATTCGCAGCACTGGTGAAGTATTCGAGCCTGTGTTCCTGTCGGCTGGTAAGTTGACGGAGGC
TATGGGTTTGGCTATCAAGACTGCTAAGGACGGCAAGGGAGAGTCGCAGCTCCGTGTGACACTCGTTGAGAATGACTGTCTGTCGGCTATCCGTTCGTTC
TTTACGGCCAGTATGTACGTGGTGAGTGCCTTGTTCGGCAACGATGACGCGGATGTGGTCGATGGTTTCCGCATGCTTGAGGAGATCGCCTCTAGTGGCG
GATTCCTGAAGTCGTTTAATGTCCGTGAGCTTGCGAGCCtgcgcgttgctgctgttgatatTCTGGAAGAGATTCTGGACCTTCCGGACCCGGATTCGCA
GTCCCAGCACATCCCGAACGCGCGTGTTCACTCGATGGGTGTGATTCGCAACTTTGtctcgaagatggaggcgttTTTGAATGGTGTGCAGTCCTTCTGC
ATTGACCCTGCTTTGCAGCGCAAGTTCGGCAACTCGAAGTTCTGCTCAAGCGCCAATGGGTACATGTTTGCTTCGCGTGGACTTGTCAACCTGTTCTGCA
GTGACACGGCTATGGGTGCTGCTACGCGTgcgtgtttgctgctgtctttggacCGATCGGAGGCTATGCCACGTACTACGGAGgcgcagcgtcgtcttgg
tttTTTCATGAAGTCACTTGTGATGGACATTCCCCAGCTGCGTTCCATCAAGGAAATGCGCAGTTTCTCGGTTGTGACCCCGTTCTACGCCGAGACGGTG
CTGTTCTCGCTGAAGGACCTGAATGACCCTCTTGTGAACCACCcgatcttccagcaggtCGAGGAGGATGGCAAGAACCTGACGATTCTGAAGTACCTGA
CGAAGATTCACCAGGAGGAATGGGACAACTTCTTGGAGCGTGTGGATGTGAGCTCCGCCGAGGAGGCCCAGAAGAACCACCCCGAAGAAATCCGTTTGTG
GGCATCGTACCGTGGCCAGACTTTGGCGCGTACGGTGCAGGGTATGATGATGTACGAGGATGCG